Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

ΧΑΡΑΚΤΗΡΙΣΜΟΣ ΤΩΝ ΓΟΝΙΔΙΩΝ ΒΜ89 ΚΑΙ ΒΜ88 ΕΘΝΙΚΟ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ.

Παρόμοιες παρουσιάσεις


Παρουσίαση με θέμα: "ΧΑΡΑΚΤΗΡΙΣΜΟΣ ΤΩΝ ΓΟΝΙΔΙΩΝ ΒΜ89 ΚΑΙ ΒΜ88 ΕΘΝΙΚΟ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ."— Μεταγράφημα παρουσίασης:

1 ΧΑΡΑΚΤΗΡΙΣΜΟΣ ΤΩΝ ΓΟΝΙΔΙΩΝ ΒΜ89 ΚΑΙ ΒΜ88 ΕΘΝΙΚΟ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ ΒΙΟΦΥΣΙΚΗΣ ΕΛΛΗΝΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΠΑΣΤΕΡ ΕΡΓΑΣΤΗΡΙΟ ΚΥΤΤΑΡΙΚΗΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΝΕΥΡΟΒΙΟΛΟΓΙΑΣ Γαϊτάνου Μαρία Επιβλέποντες: Τμήμα Βιολογίας Καθηγητής Λουκάς Χ. Μαργαρίτης Αναπληρώτρια Καθηγήτρια Ειρήνη Λεκανίδου Ελληνικό Ινστιτούτο Παστέρ Ερευνήτρια Α’ Ρεβέκκα Μάτσα Ερευνήτρια Α’ Αυγή Μαμαλάκη

2 Κύτταρα του νευρικού συστήματος Νευρώνες Κύτταρα γλοίας Αστροκύτταρα Ολιγοδενδροκύτταρα Κύτταρα Schwann KNΣ ΠNΣΠNΣ ΝευρώνεςΑστροκύτταραΟλιγοδενδροκύτταρα Sauvageot and Stiles 2002 Νευρογένεση και γλοιογένεση στον εγκέφαλο αρουραίου

3 ΜΟΡΙΑ ΠΟΥ ΕΜΠΛΕΚΟΝΤΑΙ ΣΤΗ ΝΕΥΡΙΚΗ ΔΙΑΦΟΡΟΠΟΙΗΣΗ ΜΟΡΙΑ ΕΠΙΦΑΝΕΙΑΣ ΜΟΡΙΑ ΣΥΝΑΦΕΙΑΣ π.χ NCAMs της υπεροικογένειας των ανοσοσφαιρινών καντερίνες, ιντεγκρίνες ΟΓΚΟΚΑΤΑΣΤΑΛΤΙΚΑ ΓΟΝΙΔΙΑ π.χ DCC EΝΔΟΚΥΤΤΑΡΙΚΑ ΜΟΡΙΑ ΜΕΤΑΓΡΑΦΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ GAP 43 Συναπτοταγμίνη MAP-2 Bcl 2 BM88

4  Οι πρωτεΐνες ΒΜ88 και ΒΜ89 προσδιορίστηκαν, με τη βοήθεια μονοκλωνικών αντισωμάτων σε μεμβρανικά παρασκευάσματα εγκεφάλου χοίρου.  Είναι νευροειδικά μόρια, που εμφανίζουν ευρεία κατανομή στο κεντρικό και περιφερικό νευρικό σύστημα των θηλαστικών.

5 ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ88  Νευροειδική διαμεμβρανική μη γλυκοζυλιωμένη πρωτεΐνη.  Αποτελείται από δύο ίδιες πολυπεπτιδικές αλυσίδες Μ.Β kD, που συνδέονται μεταξύ τους με S-S δεσμούς.  Η έκφραση της BM88 ξεκινά κατά την έναρξη της νευρογένεσης και αυξάνεται με την ηλικία.  Εκφράζεται από πολλαπλασιαζόμενους νευροβλάστες και, ισχυρότερα, από μετα-μιτωτικούς νευρώνες.  Εντοπίζεται στη μεμβράνη ενδοκυτταρικών οργανιδίων (ενδοπλασματικό δίκτυο, εξωτερική μεμβράνη μιτοχονδρίων).

6 ΛΕΙΤΟΥΡΓΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ88 Η πρωτεΐνη ΒΜ88 προάγει τη διαφοροποίηση και επιβραδύνει τον πολλαπλασιασμό των νευρικών κυττάρων. in vitro: Σταθερά μετασχηματισμένα με το ΒΜ88 κύτταρα του νευροβλαστώματος του ποντικού (Neuro2A), παρουσιάζουν μειωμένο ρυθμό πολλαπλασιασμού και διαφοροποίηση προς φαινότυπο νευρώνων, τόσο σε μορφολογικό όσο και σε βιοχημικό επίπεδο. (Mamalaki A. et al., J. Biol. Chem., 1995) BM88 πολλαπλασιασμός διαφοροποίηση

7 7 Η υπερέκφραση της πρωτεΐνης ΒΜ88 στα Neuro2 κύτταρα επάγει τη νευρική διαφοροποίησή τους in vitro καθώς και την έκφραση της νευροειδικής πρωτεΐνης ΒΜ89. Νeuro2AΝeurο2A-BM88 4 ημέρες 7 ημέρες ΒΜ88 BM88 BM89BM88 / BM89 N2A-BM88 N2A 25 μm

8 ΣΤΟΧΟΙ ΤΗΣ ΠΑΡΟΥΣΑΣ ΔΙΑΤΡΙΒΗΣ 1. Διαλεύκανση της πρωτεΐνικής ταυτότητας της πρωτεΐνης ΒΜ89 προκειμένου να διερευνηθεί το σηματοδοτικό μονοπάτι νευρικής διαφοροποίησης που ενεργοποιείται από την πρωτεΐνη ΒΜ88 in vitro στα Neuro2A κύτταρα. 2. Μελέτη της δράσης της πρωτεΐνης ΒΜ88 του χοίρου στους μηχανισμούς της νευρικής διαφοροποίησης in vivo, με τη δημιουργία διαγονιδιακών ποντικιών. 3. Tαυτοποίηση και μελέτη των ομόλογων ΒΜ88 πρωτεϊνών του ποντικού και του ανθρώπου, απομόνωση και μελέτη των αντίστοιχων cDNA τους καθώς και απομόνωση και χαρτογράφηση του ανθρώπινου γονιδίου ΒΜ88.

9 ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89  Νευροειδικό μόριο με ευρεία κατανομή στο Κ.Ν.Σ και το Π.Ν.Σ των θηλαστικών.  Βιοχημεία: Διαμεμβρανική γλυκοπρωτεΐνη που αποτελείται από μία πολυπεπτιδική αλυσίδα ΜΒ kD, ανάλογα με το εξεταζόμενο είδος.  Αναπτυξιακές μελέτες έδειξαν ότι η έκφραση της πρωτεΐνης ΒΜ89 συμπίπτει με την περίοδο της διαφοροποίησης των νευρώνων και της ανάπτυξης των αξόνων τους.  Η έκφραση της πρωτεΐνης ΒΜ89 στην κυτταρική σειρά N2A σχετίζεται με τις λειτουργικές ιδιότητες της πρωτεΐνης ΒΜ88.

10 ΑΠΟΜΟΝΩΣΗ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89 ΑΠΟ ΤΟΝ ΕΓΚΕΦΑΛΟ ΤΟΥ ΧΟΙΡΟΥ

11 12 kD BM89 ΠΑΡΑΣΚΕΥΗ ΠΟΛΥΚΛΩΝΙΚΟΥ ΑΝΤΙΣΩΜΑΤΟΣ 12 ΑΠΟΜΟΝΩΣΗ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89 ΤΟΥ ΠΟΝΤΙΚΟΥ ΒΙΟΧΗΜΙΚΟΣ ΧΑΡΑΚΤΗΡΙΣΜΟΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89 ΤΟΥ ΠΟΝΤΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΗΣ ΑΜΙΝΟΞΙΚΗΣ ΑΛΛΗΛΟΥΧΙΑΣ ΔΥΟ ΕΣΩΤΕΡΙΚΩΝ ΟΛΙΓΟΠΕΠΤΙΔΙΩΝ

12 Η ΑΠΟΜΟΝΩΣΗ ΤΟΥ cDNA ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89 ΤΟΥ ΠΟΝΤΙΚΟΥ ΕΔΕΙΞΕ ΟΤΙ ΤΑΥΤΙΖΕΤΑΙ ΜΕ ΤΗΝ ΠΡΩΤΕΪΝΗ ΤΩΝ ΣΥΝΑΠΤΙΚΩΝ ΚΥΣΤΙΔΙΩΝ ΣΥΝΑΠΤΟΦΥΣΙΝΗ.

13 Νουκλεοτιδική και αμινοξική αλληλουχία της συναπτοφυσίνης του ποντικού. ATGGACGTGGTGAATCAGCTGGTGGCTGGGGGTCAGTTCCGGGTGGTCAAGGAGCCCCTTGGCTTCGTGAAGGTGCTGCAGTGGGTCTTT 90 M D V V N Q L V A G G Q F R V V K E P L G F V K V L Q W V F GCCATCTTCGCCTTTGCTACGTGCGGCAGCTACACCGGAGAGCTTCGGCTGAGCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAAC 180 A I F A F A T C G S Y T G E L R L S V E C A N K T E S A L N ATCGAAGTCGAATTTGAGTACCCATTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGCGTTAAAGGGGGCACTACCAAGATCTTC 270 I E V E F E Y P F R L H Q V Y F D A P S C V K G G T T K I F CTAGTTGGTGACTACTCCTCCTCGGCTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGGGGCCCTGGCCACCTAC 360 L V G D Y S S S A E F F V T V A V F A F L Y S M G A L A T Y ATCTTCCTGCAGAACAAGTACCGAGAGAACAACAAAGGGCCAATGATGGACTTCCTGGCCACAGCAGTGTTCGCTTTCATGTGGCTAGTT 450 I F L Q N K Y R E N N K G P M M D F L A T A V F A F M W L V AGCTCATCCGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACTGACCCAGAGAACATTATCAAGGAGATGCCTATGTGCCGCCAG 540 S S S A W A K G L S D V K M A T D P E N I I K E M P M C R Q ACAGGAAACACATGCAAGGAACTGAGGGACCCTGTGACTTCAGGACTCAACACCTCGGTGGTGTTTGGCTTCCTGAACCTGGTGCTCTGG 630 T G N T C K E L R D P V T S G L N T S V V F G F L N L V L W GTTGGCAACCTATGGTTCGTGTTCAAGGAGACAGGCTGGGCCGCCCCATTCATGCGCGCACCTCCAGGCGCCCCAGAAAAGCAACCAGCT 720 V G N L W F V F K E T G W A A P F M R AP P G A P E K Q P A CCTGGCGATGCCTACGGCGATGCGGGCTATGGGCAGGGCCCCGGAGGCTATGGGCCCCAGGACTCCTACGGGCCTCAGGGTGGTTATCAA 810 P G D A Y G D A G Y G Q G P G G Y G P Q D S Y G P Q G G Y Q CCCGATTACGGGCAGCCAGCCAGCGGCGGTGGCGGTGGCTACGGGCCTCAGGGCGACTATGGGCAGCAAGGCTACGGCCAACAGGGTGCG 900 P D Y G Q P A S G G G G G Y G P Q G D Y G Q Q G Y G Q Q G A CCCACCTCCTTCTCCAATCAGATGTAATCTGGTCAGTGAAGCCCACGAAGACCCCACGGGTGGGCAAGAGCTCAAGAGAAGGCCTGCCCC 990 P T S F S N Q M * CCTTCCCATCCCCATATCCTAGGTCTCCACCCCTCAACCCAGGAGACCCTGTCTTTGCTGTTTATATATATATATATTATATATAAATAT 1080 CTATTTATCTGTCTGAGCCCTACCTTCACCCACTCCTCCATGCACTAGGGGCCCAGTCCTGAATGGGCTCCTCCCTACCCCTGACCTTGC 1170 ACTCCTCAGCCCCTATCGGTTCCCCAGCCCTGTCCCGTGATGTAAGGGGGCTCTAGAAAGGGGACAGGAAGGGGGCCAGACCTTGGCTGC 1260 ATGGAGTGGGCGATGTGACTTTTTCCCCCTTCCTTCTCTCCCTCTGCCCCTCCTAACTCTAGCCTTGGTTCCTCCAGCATCGCCTGAACT 1350 TAAGAAGCTCTCAAATGGAAATTCAACCCCAAGAGTAGAGGGGTGGAGGTGGCTTGGATGAAATGGGTGGAGAGGAGATGGCCTCTGTAG 1440 AGAGAGGACCAGTCAGCCAAAAGTTGAATTCCACACATACTGGATGTGGAGCCTAAAAGGGAAGTGGTGTCCTACACCATTCTGGAATGG 1530 GGCTAAAAGGGACTGGGGAGAGGGGTACTAGGAGGGGTGTGGCTTAAACACATGGTGGGTTCCGGAGTGGGCAGGTTTGGGTTGGATCCA 1620 GCATCTCTAGAAGGGGTGTGTCTTGGAACATTCAGGAGTTTGAGCTTGATTCCAAAGAGCTTGAGCAAGGCTAGAAGTGGGATTCGGGAA 1710 TGATCTAAGCTTGAGAGAAGGTTCTGGTCAGGATTGCAGACAGGCAGGTGAAGAGGACGAGGGATGTGTGGTGCTCTCAGAAGAGGAAGC 1800 CCATTCTGTAATGGGGCAGAAAAGAAAATACGGTTTCAGTTGAGTGGAGTTTGAGCAGTGGGTGTAGGAGGCCATGGTTGGGAGCTGTGA 1890 GGTGAGTTTTGCTAAAAGTAGGAAGGAGTACTCCTGATTCCACCCCACGCCCCAGAACGGACATAACCTGGGAAGAGCCAAGTATTGTGG 1980 TTTGGAGGGTGAGCGAAATGTCCCTTACTGACTCCCTCAGAAGAGGGCTAGATAATCAGAAGACAGAATCTACAGGTCTGTGGGGCTGGC 2070 CTACCTTCTCCACCCTTTCTCTGCCCTCTCCCTCCACACTCCCGTCTGTCCCGGAGCACTGGGAGGCTGGCTCTGGAGCCCCAATCCTGG 2160 ACCCTCTGCTGTGTCTGTGACGTTGGTAGTGCCTGTGATCGTGTGTTGCCATTTTGTCTGACTGTGGCCCCTCCCTTTTCCCTCCAGACC 2250 CCCTACTTTCCTGTGCCTTCGGTATTGTTTGAAGACCCCCCTCCCCAAGGAAGAGCAAATATGAGAACCCCCCCCAATAAACTCCTCAAC 2340 TATCAAAAAAAAAAAAAAAAAA -17 ATTCGGCACGAGCAGAC

14 Σύγκριση της αμινοξικής αλληλουχίας του μορίου της συναπτοφυσίνης ανάμεσα στα είδη Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Αρουραίος Βόδι Ανθρωπος Ποντικός ΨάριTorpedo Ποσοστά ομολογίας: 92.5% ποντικός-βόδι 94.8% ποντικός-άνθρωπος 100% ποντικός-αρουραίος

15 ΑΝΑΛΥΣΗ ΚΑΤΑ SOUTHERN TOY ΓΟΝΙΔΙΟΥ ΤΗΣ ΣΥΝΑΠΤΟΦΥΣΙΝΗΣ ΑΝΑΜΕΣΑ ΣΤΑ ΕΙΔΗ ΜΕΛΕΤΗ ΤΗΣ ΕΚΦΡΑΣΗΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ89/ ΣΥΝΑΠΤΟΦΥΣΙΝΗΣ ΤΟΥ ΠΟΝΤΙΚΟΥ poly 89 SVP-38

16 ΣΥΜΠΕΡΑΣΜΑΤΑ › Η κλωνοποίηση του cDNA της πρωτεΐνης ΒΜ89 του ποντικού έδειξε ότι το μόριο αυτό ταυτίζεται με τη συναπτοφυσίνη. Το cDNA της συναπτοφυσίνης του ποντικού κλωνοποιήθηκε για πρώτη φορά στα πλαίσια αυτής της εργασίας. › Tο μόριο της συναπτοφυσίνης είναι πολύ καλά συντηρημένο κατά τη διάρκεια της εξέλιξης, γεγονός που υποδηλώνει τη μεγάλη σημασία του βιολογικού του ρόλου. › Το ειδικό πολυκλωνικό αντίσωμα που παρασκευάστηκε μπορεί να χρησιμοποιηθεί σαν διαγνωστικό εργαλείο σε διαφόρων ειδών ανθρώπινες νεοπλασίες. Συγκεκριμένα έχει ήδη χρησιμοποιηθεί στη μελέτη ανθρώπινων αστροκυτωμάτων (Katsetos et al., Arch. Pathol. Lab. Med., 2001). › Το γεγονός ότι η έκφραση της πρωτεΐνης ΒΜ88 στα Neuro2Α κύτταρα επάγει άμεσα ή έμμεσα την έκφραση της συναπτοφυσίνης, μορίου- δείκτη της τελικής διαφοροποίησης των νευρώνων ενισχύει το νευρογενετικό ρόλο της πρωτεΐνης ΒΜ88.

17 ΜΕΛΕΤΗ ΤΗΣ ΔΡΑΣΗΣ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ88 ΤΟΥ ΧΟΙΡΟΥ ΣΤΗ ΝΕΥΡΙΚΗ ΔΙΑΦΟΡΟΠΟΙΗΣΗ ΣΕ IN VIVO ΜΟΝΤΕΛΟ ΔΙΑΓΟΝΙΔΙΑΚΩΝ ΠΟΝΤΙΚΙΩΝ. (Knittel et al., 1995) (Hoxa7)

18 Προϊόν RT-PCR (660 bp ) ΜΎ ποντικός Χοίρος B. A. AΝΙΧΝΕΥΣΗ ΤΩΝ ΟΜΟΖΥΓΩΝ ΖΩΩΝ ΩΣ ΠΡΟΣ ΤΟ ΒΜ88 - ΔΙΑΓΟΝΙΔΙΟ ΜΕ SLOT-BLOT ΑΝΑΛΥΣΗ ΜΕΛΕΤΗ ΤΗΣ ΕΚΦΡΑΣΗΣ ΤΟΥ ΒΜ88 ΔΙΑΓΟΝΙΔΙΟΥ ΤΟΥ ΧΟΙΡΟΥ ΜΕ RT- PCR ΑΝΑΛΥΣΗ ΣΕ ΔΙΑΓΟΝΙΔΙΑΚΑ ΕΤΕΡΟΖΥΓΑ ΕΜΒΡΥΑ ΠΟΝΤΙΚΟΥ ΗΛΙΚΙΑΣ Ε12.5

19 TΑΥΤΟΠΟΙΗΣΗ ΤΩΝ ΟΜΟΛΟΓΩΝ ΒΜ88 ΠΡΩΤΕΪΝΩΝ ΤΟΥ ΠΟΝΤΙΚΟΥ ΚΑΙ ΤΟΥ ΑΝΘΡΩΠΟΥ. Εγκέφαλος αρουραίου Εγκέφαλος ανθρώπου Εγκέφαλος ποντικού P0 Εγκέφαλος ποντικού Εγκέφαλος χοίρου BM88 Εγκέφαλος χοίρου Εγκέφαλος ανθρώπου Εγκέφαλος ποντικού kD Μονοκλωνικό αντίσωμα Πολυκλωνικό αντίσωμα DTT A)B)Γ) Εγκέφαλος χοίρου Εγκέφαλος ανθρώπου Εγκέφαλος ποντικού Πολυκλωνικό αντίσωμα

20 ΑΝΟΣΟΪΣΤΟΧΗΜΙΚΗ ΑΝΙΧΝΕΥΣΗ ΤΗΣ ΠΡΩΤΕΪΝΗΣ ΒΜ88 ΣΕ ΑΝΘΡΩΠΙΝΗ ΠΑΡΕΓΚΕΦΑΛΙΔΑ 300 μm 75 μm ΒΜ88 NF

21 ΑΠΟΜΟΝΩΣΗ ΚΑΙ ΜΕΛΕΤΗ ΤΩΝ cDNA ΤΟΥ ΒΜ88 ΤΟΥ ΑΝΘΡΩΠΟΥ ΚΑΙ ΤΟΥ ΠΟΝΤΙΚΟΥ

22

23 MEΛΕΤΗ ΤΗΣ ΕΚΦΡΑΣΗΣ ΤΟΥ ΓΟΝΙΔΙΟΥ ΒΜ88 ΤΟΥ ΑΝΘΡΩΠΟΥ. ανθρώπου RNA εγκεφ φλοιός παρεγκεφαλίδα προμήκης νωτιαίος μυελός μετωπιαίος λοβός κροταφιαίος λοβός κέλυφος φακοειδούς πυρήνα ινιακός πόλος BM kb kb A) B) BM88 RNA εγκεφ. ποντικού 1.8 kb RNA Hela κυττάρων Μ.Β β-ακτίνη

24 D11S 922 IGF2 DRD4 RP_P2 BM 88 HRAS H19 TH HNAP2 IPL/ TSSC3 D11S ,50 33,60 22,52 cR 3000 CTSD BM88 11q23 BM88 11q23 B.A. ΕΝΤΟΠΙΣΜΟΣ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΒΜ88 ΓΟΝΙΔΙΟΥ ΣΤΟ ΧΡΩΜΟΣΩΜΑ 11p15.5 ( LOC51286, Radiation Hybrid Mapping Consortium, NCBI)

25 Χαρακτηριστικά της περιοχής 11p15.5 του ανθρώπινου χρωμοσώματος 11. Εμπεριέχει γενωμικά «εντυπωμένα» γονίδια (IGF2, H19, TSSC3 ) και συνδέεται με πολλές ανθρώπινες ασθένειες, όπως αναπτυξιακές ανωμαλίες (σύνδρομο Beckwith- Wiedemann) και την καρκινογένεση.

26 › Απομονώθηκαν τα cDNA του ΒΜ88 του ανθρώπου και του ποντικού και ταυτοποιήθηκαν οι ομόλογες πρωτεΐνες ΒΜ88. › Η ανάλυση της αμινοξικής αλληλουχίας της πρωτεΐνης ΒΜ88 έδειξε την ύπαρξη επαναλήψεων προλίνης του τύπου PXXP, οι οποίες και καθιστούν την πρωτεΐνη ΒΜ88 ως υποψήφιο μόριο για αλληλεπιδράσεις με πρωτεΐνες που περιέχουν SH3 περιοχές (Src- homology domain) στην αμινοξική τους αλληλουχία. › Ο χρωμοσωμικός εντοπισμός του ανθρώπινου γονιδίου ΒΜ88 στο χρωμόσωμα 11p15.5 σε συνδυασμό με τις ιδιότητές του υποδηλώνουν πιθανή εμπλοκή του ΒΜ88 σε αναπτυξιακές ανωμαλίες ή την καρκινογένεση. ΣΥΜΠΕΡΑΣΜΑΤΑ

27 ΜΕΛΛΟΝΤΙΚΟΙ ΣΤΟΧΟΙ: Να εξεταστεί εάν το ΒΜ88 γονίδιο είναι γενωμικά εντυπωμένο. Να εξεταστεί εάν το ανθρώπινο ΒΜ88 γονίδιο εμπλέκεται σε ανθρώπινες ασθένειες. Να μελετηθεί το σηματοδοτικό μονοπάτι στο οποίο συμμετέχουν οι πρωτεΐνες ΒΜ88 και ΒΜ89/συναπτοφυσίνη στους μηχανισμούς της νευρικής διαφοροποίησης.

28 Η πρωτεΐνη BM88 έχει διπλό ρόλο: συντονίζει την έξοδο από τον κυτταρικό κύκλο και τη διαφοροποίηση των προδρόμων νευρικών κυττάρων BM88/Synaptophysin BM88/TuJ-1 Neuro2aNeuro2a-BM88 Neuro2aNeuro2a-BM88 p21 p53 E2F Growth arrest stimuli BM88 cell-cycle signaling pathway +Rb+2μg cDNA BM88+Rb+4μg cDNA BM88 +Rb +Rb+PC3 +Rb+adeno-88 +Rb+cyclinD1 Cyclin D1/BM88 N2A N2A-BM88 NIH-3T3 cells Cyclin D1 Cyclin B1 N2A Control N2A BM88-C3C1 N2A BM88-C7G5 Cyclin E α-tubulin p53 BM88 Georgopoulou et al., J Biol Chem., 2006

29 Ευχαριστώ… Τριμελής επιτροπή Μαργαρίτης Λ. Λεκανίδου Ρ. Μάτσα Ρ. Επιβλέποντες Μάτσα Ρ. Μαμαλάκη Α. Εργαστήριο Κυτταρικής και Μοριακής Νευροβιολογίας Θωμαΐδου Δ. Πολίτης Π. Λάβδας Α. Hurel C. Παπαστεφανάκη Φ. Σεργάκη Μ. Μακρή Γ. Κατσιμπάρδη Λ. Τσιώρας Κ. Κουρούπη Γ. Πρώην μέλη της ομάδας Μπούτου Φ. Παπαδόδημα Ο. Κουτμάνη Γ.

30 Ν2Α-ΒΜ88 εκφράζουν NF, βIII -tubulin, SMI311 BM89/synaptophysin Μεγαλύτερη απόκκριση σε b-FGF FGF-R, NCAM

31

32

33

34

35 Η διπλή χρώση ανοσοτυπωμάτων δύο διαστάσεων σε πρωτεϊνικά παρασκευάσματα εγκεφάλου χοίρου έδειξε ότι τόσο το μονοκλωνικό όσο και το πολυκλωνικό αντίσωμα έναντι της πρωτεΐνης ΒΜ89 αναγνωρίζουν τη συναπτοφυσίνη όπως και το ειδικό αντίσωμα SVP-38 του εμπορίου. mab89 και poly 89 SVP-38 και poly 89

36 Κύτταρα του νευρικού συστήματος Προγονικό κύτταρο νευρώνων Νευρώνας Πολυδύναμο προγονικό κύτταρο Πολυδύναμο προγονικό κύτταρο Μεταγραφικοί παράγοντες Ομοιοτικοί (Emx, Pax) bHLH (ngn, mash, neuroD) Ενεργοποίηση νευροειδικών γονιδίων


Κατέβασμα ppt "ΧΑΡΑΚΤΗΡΙΣΜΟΣ ΤΩΝ ΓΟΝΙΔΙΩΝ ΒΜ89 ΚΑΙ ΒΜ88 ΕΘΝΙΚΟ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΚΥΤΤΑΡΟΥ ΚΑΙ."

Παρόμοιες παρουσιάσεις


Διαφημίσεις Google