Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Μονογονιδιακές ασθένειες Βασιλική Αλεπόρου-Μαρίνου Αναπλ.Καθηγήτρια.

Παρόμοιες παρουσιάσεις


Παρουσίαση με θέμα: "Μονογονιδιακές ασθένειες Βασιλική Αλεπόρου-Μαρίνου Αναπλ.Καθηγήτρια."— Μεταγράφημα παρουσίασης:

1 Μονογονιδιακές ασθένειες Βασιλική Αλεπόρου-Μαρίνου Αναπλ.Καθηγήτρια

2 Γενετικές ασθένειες  Μονογονιδιακές  Χρωμοσωμικές  Μιτοχονδριακές  Πολυπαραγοντικές

3 Χρωμοσωμικές γενετικές ασθένειες  100 γνωστές ασθένειες  Δομικές σύνδρομο «φωνή της γάτας» σύνδρομο «φωνή της γάτας»  Αριθμητικές σύνδρομο Down σύνδρομο Down  Μονογονεϊκή δισωμία κληρονομικότητα ζεύγους χρωμοσωμάτων μόνο από τον ένα γονέα κληρονομικότητα ζεύγους χρωμοσωμάτων μόνο από τον ένα γονέα  Μωσαϊκισμός διαφορετικός αριθμός χρωμοσωμάτων σε διαφορετικά κύτταρα, σε άλλα 46, σε άλλα 47 διαφορετικός αριθμός χρωμοσωμάτων σε διαφορετικά κύτταρα, σε άλλα 46, σε άλλα 47

4 Μονογονιδιακές ασθένειες  Δημιουργούνται από τη μετάλλαξη ενός γονιδίου που έχει μεγάλη επίδραση στον οργανισμό  Ακολουθούν Μενδελική κληρονομικότητα  Αυτοσωμικές επικρατείς, αυτοσωμικές υπολειπόμενες, X-φυλοσύνδετες & Y- φυλοσύνδετες

5 Σύντομη υπενθύμιση  Αυτοσώματα Χρωμοσώματα 1-22 Χρωμοσώματα 1-22 Ένα άτομο κληρονομεί ένα χρωμόσωμα από τον πατέρα και ένα από τη μητέρα Ένα άτομο κληρονομεί ένα χρωμόσωμα από τον πατέρα και ένα από τη μητέρα Ονομάζονται πατρικό και μητρικό αντίγραφο Ονομάζονται πατρικό και μητρικό αντίγραφο  Φυλετικά χρωμοσώματα X και Y X και Y Ένα θηλυκό άτομο κληρονομεί ένα X από τη μητέρα και ένα Χ από τον πατέρα Ένα θηλυκό άτομο κληρονομεί ένα X από τη μητέρα και ένα Χ από τον πατέρα Ένα αρσενικό κληρονομεί ένα X από τη μητέρα και ένα Y από τον πατέρα Ένα αρσενικό κληρονομεί ένα X από τη μητέρα και ένα Y από τον πατέρα

6 Αυτοσωμικό επικρατές χαρακτηριστικό AαAααα Aα α Φαινότυπος Γονότυπος Γαμέτες α A α α Ζυγώτης Φαινότυπος

7 Αυτοσωμικό επικρατές χαρακτηριστικό Μεταβίβαση από άνδρα σε γυναίκα και αντίστροφα Τα νοσούντα άτομα έχουν γονέα που νοσεί επίσης Ένα αντίγραφο του μεταλλαγμένου γονιδίου = ασθένεια 50% πιθανότητα κληρονόμησης στους απογόνους Κάθετη κληρονομικότητα Ατελής οστεογένεσηΚολλαγόνο Αχονδροπλασία Υποδοχέας αυξητικού παράγοντα ινοβλαστών

8 AαAαAαAα Aα α Φαινότυπος Γονότυπος Γαμέτες α A A A Ζυγώτης Φαινότυπος A a α A α Αυτοσωμική υπολειπόμενη

9 Μεταβίβαση από άνδρα σε γυναίκα και αντίστροφα Δυο αντίγραφα του μεταλλαγμένου γονιδίου = ασθένεια 50% των απογόνων φορείς & 25% των απογόνων νοσούν Η ομομιξία αυξάνει τη συχνότητα νοσούντων ατόμων Οριζόντια κληρονομικότητα Κυστική ίνωσηCF παράγοντας Δρεπανοκυτταρική αναιμία  -σφαιρίνη

10 αAαAα α α Φαινότυπος Γονότυπος Γαμέτες Φαινότυπος A α αα A Θηλυκοί ζυγώτες A α Αρσενικοί ζυγώτες XYXYXX X-φυλοσύνδετη υπολειπόμενη

11 Οι γυναίκες είναι φορείς, οι άνδρες νοσούν Η γυναίκα φορέας θα μεταβιβάσει κατα 50% στους γιούς(νοσούν) και κατά 50% σε κόρες (φορείς) Οι νοσούντες ‘άνδρες δεν μεταβιβάζουν σε γιους αλλά μεταβιβάζουν κατα 100% σε κόρες (φορείς) 50% λειτουργικότητα επαρκής για φυσιολογικό φαινότυπο Μυική δυστροφία Duchenne Δυστροφίνη Αιμοροφιλία A Παράγοντας VIII

12 Μια X-φυλοσύνδετη υπολειπόμενη ασθένεια μπορεί περιστασιακά να εμφανίζει νοσούντα θηλυκά άτομα AαAα A AA Αληθείς ομοζυγώτες Σύνδρομο Turner (XO) Σπάνια αδρανοποίηση του X X-μετατόπιση με αυτόσωμα α AαAα A α

13 X-φυλοσύνδετη επικρατής Νοσούν και άνδρες και γυναίκες Οι γυναίκες είναι ελαφρύτερα προσβεβλημένες Οι προσβεβλημένες γυναίκες μεταβιβάζουν κατα 50% στους γιους και κατά 50% στις κόρες Οι προσβεβλημένοι άνδρες δεν μπορούν να μεταβιβάσουν στους γιούς αλλά μεταβιβάζουν κατα 100% στις κόρες

14 Y-φυλοσύνδετη Προσβάλλονται μόνο άνδρες Οι προσβεβλημένοι άνδρες έχουν πάντοτε προσβεβλημένο πατέρα Όλοι οι γιοί ενός προσβεβλημένου πατέρα νοσούν

15 Περιπλοκές στα πρότυπα Μενδελικής κληρονομικότητας  Ατελής διεισδυτικότητα  Ποικίλη εκφραστικότητα  Επίσπευση  Μωσαϊκισμός

16 Διεισδυτικότητα  Η πιθανότητα ένα άτομο που έχει το φαινότυπο να εκδηλώσει την ασθένεια  Εμφανίζεται κυρίως σε επικρατείς καταστάσεις Πλήρης διεισδυτικότητα – όλοι οι ετερόζυγοι εκφράζουν το φαινότυπο Πλήρης διεισδυτικότητα – όλοι οι ετερόζυγοι εκφράζουν το φαινότυπο Ατελής διεισδυτικότητα – όλοι οι ετερόζυγοι δεν εμφανίζουν το φαινότυπο Ατελής διεισδυτικότητα – όλοι οι ετερόζυγοι δεν εμφανίζουν το φαινότυπο  Η ατελής διεισδυτικότητα εκδηλώνεται σαν «χάσιμο του χαρακτήρα» σε μια γενιά

17 Αιτίες ατελούς διεισδυτικότητας  Ο γονότυπος δεν δρα σε απομόνωση Αλληλεπίδραση με το άγριου τύπου γονίδιο Αλληλεπίδραση με το άγριου τύπου γονίδιο Αλληλεπίδραση με άλλα γονίδια Αλληλεπίδραση με άλλα γονίδια Αλληλεπίδραση με το περιβάλλον Αλληλεπίδραση με το περιβάλλον Τυχαίο γεγονός Τυχαίο γεγονός

18 Ατελής διεισδυτικότητα Σημείωση – η ασθένεια για ένα άτομο είναι είτε διεισδυτική είτε όχι ένα άτομο χωρίς διεισδυτικότητα

19 Ποικίλη εκφραστικότητα  Η ποικίλη έκταση ή ένταση των φαινοτυπικών συμπτωμάτων μεταξύ ατόμων με τον ίδιο γονότυπο Διαφορετικά άτομα μέσα σε μια οικογένεια με την ίδια ασθένεια εμφανίζουν διαφορετικής βαρύτητας συμπτώματα Διαφορετικά άτομα μέσα σε μια οικογένεια με την ίδια ασθένεια εμφανίζουν διαφορετικής βαρύτητας συμπτώματα  Αιτίες? Ίδιες με την ατελή διεισδυτικότητα Οι γονότυποι δεν δρουν μεμονωμένα Οι γονότυποι δεν δρουν μεμονωμένα Αλληλεπίδραση με άγριου τύπου γονίδιοΑλληλεπίδραση με άγριου τύπου γονίδιο Αλληλεπίδραση με άλλα γονίδιαΑλληλεπίδραση με άλλα γονίδια Αλληλεπίδραση με περιβάλλον ή απλώς τύχηΑλληλεπίδραση με περιβάλλον ή απλώς τύχη

20 Περίεργοι μηχανισμοί κληρονόμησης  Νέοι / Περίεργοι μηχανισμοί Μωσαϊκισμός Μωσαϊκισμός Αποτύπωση Αποτύπωση Μονογονεϊκή δισωμία-Uniparental disomy (UPD)Μονογονεϊκή δισωμία-Uniparental disomy (UPD) Ασταθές DNA (επαναλήψεις τρινουκλεοτιδίων) Ασταθές DNA (επαναλήψεις τρινουκλεοτιδίων) Μητρική (Κυτταροπλασματική) κληρονομικότητα Μητρική (Κυτταροπλασματική) κληρονομικότητα

21 Μωσαϊκισμός  Όταν ένα άτομο έχει δύο ή περισσότερες γενετικά διαφορετικές κυτταρικές σειρές που προέρχονται από ένα ζυγωτό  Προκαλείται από μια νέα μετάλλαξη  Μπορεί να είναι σωματική ή γεννητική

22 Μωσαϊκό γεννητικής σειράς Μη μωσαϊκά αρσενικά που μεταβιβάζουν μια αυτοσωμική επικρατή ασθένεια Αρσενικό μωσαϊκό γεννητικής σειράς Μπορεί να γίνει λανθασμένη διάγνωση ότι πρόκειται για αυτοσωμική υπολειπόμενη ασθένεια ενώ πρόκειται για de novo κληρονομική ασθένεια στην ασθενή κόρη

23 Σωματικό μωσαϊκό διαφοροποίηση και πολλ/σμος Πρόδρομα κύτταρα οστών

24 Μωσαϊκισμός σε Τρισωμία 8

25 Μονογονιδιακές ασθένειες μπορεί να εμφανίζονται σε μορφή μωσαϊκού Proteus syndrome

26 Αποτύπωση  Τα περισσότερα γονίδια εκφράζονται το ίδιο από τα πατρικά και μητρικά αλληλόμορφα  Η γενωμική αποτύπωση είναι η έκραση ενός γονιδίου πατρικής μόνο προέλευσης που προκαλείται από μη έκφραση του μητρικού αλληλόμορφου  Ο μηχανισμός της αποτύπωσης φαίνεται να οφείλεται στην μεθυλίωση των CpG-πλούσιων περιοχών, που πιθανόν συμβαίνει στη γαμετογένεση

27 Αποτυπωμένα γονίδια  Περίπου  Έχουν ρόλο σε διάφορες φάσεις της ανάπτυξης Εμβρυική ανάπτυξη Εμβρυική ανάπτυξη Κυτταρικό πολλαπλασιασμό Κυτταρικό πολλαπλασιασμό Ανάπτυξη εγκεφάλου Ανάπτυξη εγκεφάλου Συμπεριφορά Συμπεριφορά

28 Η αποτύπωση στις γενετικές ασθένειες  Κάποιες γενετικές ασθένειες σχετίζονται με αυτό το φαινόμενο  Προκαλούνται από Μονογονεϊκή δισωμία (x2 του ίδιου ή καθόλου έκφραση) Μονογονεϊκή δισωμία (x2 του ίδιου ή καθόλου έκφραση)

29 Σύνδρομο Prader-Willi 70% έλλειψη του 15q12 πατρικής προέλευσης 25% έχουν matUPD15

30 Angelman syndrome 70% have maternally-derived deletion of 15q12 2% have patUPD15

31 Δυναμικές Μεταλλάξεις  Μια μεταλλαξη που αλλάζει κατά τη μεταβίβαση  Καλύτερο παράδειγμα οι επαναλήψεις τριπλετών Τρία νουκλεοτίδια που βρίσκονται σε αυξημένο αριθμό Τρία νουκλεοτίδια που βρίσκονται σε αυξημένο αριθμό π.χ. CAGCAGCAGCAGCAGCAGCAGCAGCAG π.χ. CAGCAGCAGCAGCAGCAGCAGCAGCAG Τρινουκλεοτιδικές επαναλήψεις  Φυσιολογικό  Ασθένεια που προκαλείται από επέκταση επαναλήψεων πάνω από κάποιο όριο  Κάτω από αυτό το όριο είναι σταθερές σε μίτωση και μείωση  Πάνω από αυτό το όριο ασταθείς

32 Δυναμικές Μεταλλάξεις

33 ATG TAA 5’3’ CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG Fragile X syndromeFriedreich Ataxia Huntington disease DRPLA SBMA SCA1 SCA2 SCA3 SCA6 SCA7 Myotonic dystrophy Θέση τρινουκλεοτιδικών επαναλήψεων στον άνθρωπο

34 Δυναμικές Μεταλλάξεις  Αστάθεια στις γενιές Η επανάληψη αλλάζει σε μέγεθος από τους γονείς στους απογόνους Η επανάληψη αλλάζει σε μέγεθος από τους γονείς στους απογόνους Βασικό το φύλο του γονέα Βασικό το φύλο του γονέα Κάποιες πιο ασταθείς από τον πατέρα,άλλες από τη μητέρα Κάποιες πιο ασταθείς από τον πατέρα,άλλες από τη μητέρα  Επίσπευση Πιο σοβαρός φαινότυπος στις επόμενες γενιές Πιο σοβαρός φαινότυπος στις επόμενες γενιές  Προμεταλλάξεις Μέγεθος επαναλήψεων που είναι ασταθές αλλά δεν αλλάζει το φαινότυπο Μέγεθος επαναλήψεων που είναι ασταθές αλλά δεν αλλάζει το φαινότυπο Σύνδρομο του ευθραύστου X Σύνδρομο του ευθραύστου X  Σχέση γονότυπου-φαινότυπου Σε όλες τις επαναλήψεις τρινουκλεοτιδίων, όσο μεγαλύτερο το μέγεθος της επανάληψης τόσο σοβαρότερα τα συμπτώματα και με πιο πρώιμη έναρξη Σε όλες τις επαναλήψεις τρινουκλεοτιδίων, όσο μεγαλύτερο το μέγεθος της επανάληψης τόσο σοβαρότερα τα συμπτώματα και με πιο πρώιμη έναρξη

35 Επίσπευση: Κάποιες ασθένειες είναι πιο σοβαρές στα παιδιά από τους γονείς Myotonic dystrophy

36 Μυοτονική Δυστροφία  Μυϊκή αδυναμία / καταρράκτης / μυοτονία/ στειρότητα  Επανάληψη CTG  <37- κανένα πρόβλημα >50- Ασθένεια >50- Ασθένεια Γενικά ήπια Γενικά ήπια Συγγενής >1000 Συγγενής >1000  Πιο σοβαρή σε επόμενες γενιές ( Επίσπευση)

37 Σύνδρομο Εύθραυστου X

38 Σύνδρομο Ευθραυστου X  Επανάληψη CGG  <50- Φυσιολογικό και χωρίς κίνδυνο σε απογόνους  = προμετάλλαξη- Φυσιολογικό αλλά κίνδυνος σε απογόνους γυναικών  >200- άνδρες με διανοητική καθυστέρηση, στις γυναίκες ποικίλει η νοητική κατάσταση

39 Ασθένεια Huntington  Προοδευτική νευροεκφυλιστική ασθένεια  Συχνότητα 1:  Αυτοσωμική επικρατής  Το γονίδιο προσδιορίστηκε το 1993  Επανάληψη CAG  Polyglutamine  Αστάθεια Επαναλήψεις >29 Αστάθεια Επαναλήψεις >29 Αστάθεια  Πρωτεΐνη = Huntingtin- Άγνωστη λειτουργία

40 Ασθένεια Huntington : Σχέση μεγέθους επαναλήψεων και έναρξης της ασθένειας

41 Online Mendelian Inheritance in Man OMIM άριστη πηγή παραδειγμάτων Μενδελικών κληρονομικών ασθενειών του ανθρώπου

42 Μερικά παραδείγματα μονογονιδιακών ασθενειών

43 Ατελής οστεογένεση-Osteogenesis imperfecta (OI) - μια αυτοσωμική επικρατής ασθένεια  Προκαλείται από μια μετάλλαξη σε ένα από τα δύο γονίδια που κωδικοποιούν το τύπου I κολλαγόνο COL1A1 - χρωμόσωμα 17q COL1A1 - χρωμόσωμα 17q COL1A2 - χρωμόσωμα 7q COL1A2 - χρωμόσωμα 7q Συχνότητα: 1/20,000 γεννήσεις Συχνότητα: 1/20,000 γεννήσεις  Το τύπου I κολλαγόνο είναι βασικό δομικό συστατικό της εξωκυτταριας θεμέλιας ουσίας πολλών ιστών περιλαμβανομένων των τενόντων, οστών και δέρματος  Στα κλινικά συμπτώματα περιλαμβάνονται εύθραυστα οστά, σπασίματα, κακός σχηματισμός, κώφωση κ.α

44 Τριπλή έλικα κολλαγόνου Μετάλλαξη

45 Εύθραυστα οστάΚώφωσηΜαλακά δόντια Blue sclerae Ποικίλη εκφραστικότητα: οι ετεροζυγώτες έχουν διαφορετικό φαινότυπο Ένα γενεαλογικό δένδρο OI που εμφανίζει ατελή διεισδυτικότητα και ποικίλη εκφραστικότητα

46 Κυστική ίνωση (CF) – μια αυτοσωμική υπολειπόμενη ασθένεια  Ασθενείς ομόζυγοι: 1/2000  Φορείς (ετερόζυγοι): 1/22  Προκαλείται από μεταλλάξεις στο γονίδιο του διαμεμβρανικού ρυθμιστή διαπερατότητας (CFTR) στο χρωμόσωμα 7q31  Στα κλινικά συμπτώματα περιλαμβάνονται παγκρεατική ανεπάρκεια και πνευμονικές λοιμώξεις

47 Λειτουργία του CFTR Ρυθμίζει τη ροή ιόντων χλωρίου μέσω της κυτταρικής μεμβράνης

48 Αιμορροφιλία A Μια X-φυλοσύνδετη υπολειπόμενη ασθένεια  Προκαλείται από μεταλλάξεις στο γονίδιο του παράγοντα πήξης VIII (F8) στο χρωμόσωμα Xq28  Συχνότητα: 1/5,000 γεννήσεις αρρένων

49 Κλινικά συμπτώματα Αιμορραγία των αρθρώσεων και μυών, εύκολα μελανιάσματα, και παρατεταμένη αιμορραγία.

50 Μιτοχονδρική κληρονομικότητα

51 Μιτοχόνδρια – κυτταροπλασματικά οργανίδια στα οποία γίνεται η παραγωγή ενέργειας από την οξειδωτική φωσφορυλίωση Κάθε μιτοχόνδριο περιέχει κυκλικό δίκλωνο DNA

52 Βασικές γνώσεις:  Τα σπερματοζωάρια δεν μεταβιβάζουν τα μιτοχόνδρια στο ωοκύτταρο κατά τη γονιμοποίηση  Συνεπώς όλα τα μιτοχόνδρια προέρχονται από τη μητέρα  Το μιτοχονδριακό DNA επομένως έχει μητρική προέλευση

53 Προσβάλλονται και άνδρες και γυναίκες Οι ασθενείς μητέρες θα μεταβιβάσουν κατά100% στους γιους και κατά100% στις κόρες Οι ασθενείς άνδρες δεν μεταβιβάζουν ούτε σε γιούς ούτε σε κόρες Μιτοχονδριακή κληρονομικότητα

54 Προβλήματα στο πρότυπο της μιτοχονδριακής κληρονομικότητας  Τα κυτταρα περιέχουν πολλά μιτοχόνδρια το καθένα με το δικό του μιτοχονδριακό γονιδίωμα  Ένα κύτταρο μπορεί να είναι ομοπλασμικό Το γονιδίωμα όλων των μιτοχονδρίων είναι ίδιο Το γονιδίωμα όλων των μιτοχονδρίων είναι ίδιο  Η μπορεί να είναι ετεροπλασμικό Δυο ή περισσότερες ποικιλίες μιτοχονδριακού γονιδιώματος Δυο ή περισσότερες ποικιλίες μιτοχονδριακού γονιδιώματος

55 Ετεροπλασμία σε μιτοχονδριακές ασθένειες Πυρήνας Μιτοχόνδρια, καθένα με το δικό του γονιδίωμα = αγριου-τύπου = μεταλλαγμένο

56 Μιτοχονδριακή κληρονομικότητα Επιπλοκές Ατελής διεισδυτικότητα Ποικίλη εκφραστικότητα

57 I II III IVV ATP “Μιτοχονδριακές ασθένειες” = Διαταραχές της αναπνευστικής αλυσίδας

58 Μιτοχονδριακές ασθένειες  Περιέχουν κυκλικό δίκλωνο DNA  Το μιτοχονδριακό γονιδίωμα είναι 16.6kb 22 tRNA γονίδια 22 tRNA γονίδια 13 γονίδια που κωδικοποιούν πρωτεΐνες της αναπνευστικής αλυσίδας 13 γονίδια που κωδικοποιούν πρωτεΐνες της αναπνευστικής αλυσίδας 2 r RNA γονίδια 2 r RNA γονίδια  Οι διαταραχές σχετίζονται με μεταλλάξεις των γονιδίων του μιτοχονδριακού DNA Συνήθως έχουν επίπτωση σε νευρικούς/μυϊκούς ιστούς Συνήθως έχουν επίπτωση σε νευρικούς/μυϊκούς ιστούς

59 MELAS MERRF NARP LHON base pairs maternally inherited multiple copies Common mtDNA mutations Συνήθεις μιτοχονδριακές μεταλλάξεις

60 Μιτοχονδριακή κληρονομικότητα

61 Η κύρια λειτουργία των μιτοχονδρίων είναι η παραγωγή ATP. Αυτό γίνεται στην αναπνευστική αλυσίδα των μιτοχονδρίων, όπου διάφορες πρωτεΐνες μετατρέπουν την ενέργεια από τη λήψη τροφής σε ATP.

62  Οι πρωτεΐνες της αναπνευστικής αλυσίδας φτιάχνονται τόσο από πυρηνικά όσο και από μιτοχονδριακά γονίδια  Από τις 100 περίπου πρωτεΐνες αυτές, οι 13 φτιάχνονται από τα μιτοχονδριακά γονίδια

63 Το μιτοχονδριακό DNA του ανθρώπου (mtDNA) Κάθε κύτταρο του ανθρώπου περιέχει μιτοχόνδρια. Σε ένα ωοκύτταρο περίπου μόρια mtDNA (επαύξηση του mtDNA). Κάθε μιτοχόνδριο περιέχει 2-10 μόρια mtDNA. Το mtDNA αποτελεί το 1% περίπου του ολικού κυτταρικού DNA. Κυκλικό, δίκλωνο DNA αποτελείται από μια βαριά (H) αλυσίδα, πλούσια σε G και μια ελαφριά (L) αλυσίδα, πλούσια σε C. Περιέχει np, έχει προσδιορισθεί η αλληλουχία σε 37 γονίδια.

64 Μιτοχονδριακό DNA Το γονιδίωμα κωδικοποιεί 22 tRNAs, 2 rRNAs (16S και 12S rRNA) και 13 πρωτεΐνες. Οι πρωτεΐνες είναι συστατικά της αναπνευστικής αλυσίδας, σύμπλοκο I (ND1-6, & 4L), III (Cyt b – cytochrome b) και IV (COX1-3), και ATP συνθετάση (A8 and A6). NCR =μη κωδικοποιούσα περιοχή

65 Κωδικοποιεί: 1) 13 πρωτεϊνικές υπομονάδες της αναπνευστικής αλυσίδας (σε σύνολο 67 περίπου): 7 υπομονάδες της αφυδρογονάσης NADH (σύμπλοκο I), κυτόχρωμα b του συμπλοκου III, 3 υπομονάδες της κυτοχρωμικής οξειδάσης (σύμπλοκο IV), 2 υπομονάδες της ATP συνθετάσης (σύμπλοκο V). 2) 16S και 12S mt rRNAs. 3) 22 mt tRNAs. Ο γενετικός κώδικας διαφέρει σε κάποιο βαθμό από τον κανονικό: UGA (συνήθως κωδικόνιο λήξης) διαβάζεται σαν Trp AGA κωδικόνιο για Arg κωδικόνιο λήξης AGG-“- -“- AUAκωδικόνιο για Ileu Met

66 Περιέχει πολύ λίγες αμετάφραστες αλληλουχίες. Περίπου 93% κωδικοποιητικό DNA. Απουσία εσωνίων. Συνεχής μεταγραφή πολλαπλών γονιδίων. Όχι ανασυνδυασμός. Σε φυσιολογικά άτομα το 99,9% περίπου των μορίων του mtDNA είναι πανομοιότυπα (ομοπλασμία). Εάν δημιουργηθεί μια νέα μετάλλαξη και εξαπλωθεί στα μόρια του mtDNA, θα δημιουργηθούν δυο γονότυποι mtDNA (ετεροπλασμία). Υψηλή συχνότητα μετάλλαξεων (δεκαπλάσια σε σύγκριση με το πυρηνικό DNA). Κατά τη μίτωση, τα μόρια του mtDNA του κυττάρου που διαιρείται διαχωρίζονται με τυχαίο τρόπο στα δυο θυγατρικά κύτταρα. Μητρική κληρονομικότητα.

67 Ετεροπλασμία- Ομοπλασμία

68 Μιτοχονδριακή κληρονομικότητα=μητρική κληρονομικότητα  Όταν μια μιτοχονδριακή ασθένεια προκαλείται από βλάβες στο πυρηνικό DNA τότε ακολουθεί Μενδελική κληρονομικότητα  Όταν προκαλείται από βλάβες στο mtDNA, το πρότυπο είναι πιο πολύπλοκο  Κάθε άτομο κληρονομεί μόνο από τη μητέρα του εκατοντάδες χιλιάδες αντίγραφα των 37 μιτοχονδριακών γονιδίων (και όχι ένα αντίγραφο από τον πατέρα και ένα από τη μητέρα)  Ο πατέρας δεν κληρονομεί τις μεταλλάξεις του mtDNA του στους απογόνους ενώ η μητέρα τις κληρονομεί σε όλους τους απογόνους -μητρική κληρονομικότητα

69 Μιτοχονδριακή κληρονομικότητα

70 Bottleneck effect  Όταν μια μετάλλαξη συμβεί στο mtDNA μόνο μερικά από τα πολλά αντίγραφα θα έχουν τη μετάλλαξη (ετεροπλασμία)  Η αναλογία μεταλλαγμένων προς φυσιολογικών mtDNA σε κάθε ιστό θα καθορίζει τη σοβαρότητα της ασθένειας  Παρόλο που κάθε απόγονος κληρονομεί τις μεταλλάξεις του mtDNA από τη μητέρα του, η σοβαρότητα της ασθένειας διαφέρει  Η αναλογία μεταλλαγμένου προς φυσιολογικό mtDNA που κληροδοτεί η μητέρα σε κάθε παιδί διαφέρει  Μια μητέρα με πολύ ελαφριά συμπτώματα μπορεί να δώσει απόγονο με σοβαρή μορφή της ασθένειας ή και απόγονο με καθόλου συμπτώματα

71 Bottleneck effect

72 Μεταλλάξεις του μιτοχονδριακού DNA 1. Διάφοροι τύποι 2. Συνήθως επηρεάζονται οι ιστοί που απαιτούν υψηλά ποσά ενέργειας (ΚΝΣ, σκελετικοί και καρδιακοί μύες, νησίδια παγκρέατος, ήπαρ, νεφροί ). 3. Κατά την κυτταρική διαίρεση, η αναλογία του μεταλλαγμένου mtDNA στα θυγατρικά κύτταρα μπορεί να αλλάξει. Το επίπεδο της ετεροπλασμίας μπορεί να διαφέρει ανάμεσα σε διάφορους ιστούς και κύτταρα.

73 4. Ένας minimum κρίσιμος αριθμός (ουδός) μεταλλαγμένων mtDNAs πρέπει να υπάρχει στα κύτταρα προτού εμφανιστούν συμπτώματα δυσλειτουργίας των ιστών καθώς και κλινικά συμπτώματα. 5. Το επίπεδο των μεταλλαγμένων mtDNAs μπορεί να αλλάξει σε κάθε μεταβίβαση μιτοχονδρίων από τη μητέρα στα παιδιά της ( bottleneck effect, αλλαγές στην ετεροπλασμία) 6. Συσσώρευση ελλείψεων mtDNA σχετίζεται με την ηλικία. Υπερισχύουν σε ιστούς που δεν διαιρούνται (εγκέφαλος, σκελετικοί μύες) Μεταλλάξεις του μιτοχονδριακού DNA

74 Το φαινόμενο του ουδού (threshold effect)  Η μιτοχ. ασθένεια που προκαλείται από μεταλλάξεις στο πυρηνικό DNA έχει τα ίδια συμπτώματα μέσα στην οικογένεια. Όταν προκαλείται από μετάλλαξη σε mtDNA τα συμπτώματα διαφέρουν στα μέλη μιας οικογένειας  Εγκεφαλομυοπάθεια. Στη μητέρα απλώς μυϊκή αδυναμία σε πόδια. Το πρώτο παιδί παράλυτο. Το δεύτερο παιδί εγκεφαλοπάθεια.  Το ποσοστό μεταλλαγμένων μιτοχονδρίων σε κάθε ιστό διαφέρει. Οι διάφοροι ιστοί έχουν διαφορετικές ενεργειακές ανάγκες άρα και το ποσοστό της μετάλλαξης που απαιτείται για να δημιουργηθεί πρόβλημα- φαινόμενο του ουδού  Το 70% του μεταλλαγμένου mtDNA σε ήπαρ μπορεί να μη δημιουργεί πρόβλημα. Δημιουργεί σε εγκέφαλο—ουδός ενέργειας

75 Κατηγορίες μιτοχονδριακών ασθενειών

76 1. Ασθένειες που προκαλούνται από μεταλλάξεις στο mt DNA Συχνότητα 1 : Ασθένειες που προκαλούνται από μεταλλάξεις στο πυρηνικό DNA Παραδείγματα: 2.1.Friedreich αταξία Προοδευτική εγκεφαλική αταξία. Προοδευτική εγκεφαλική αταξία. Αυτοσωμική υπολειπόμενη ασθένεια. Ανεπάρκεια της αναπνευστικής αλυσίδας των μιτοχονδρίων. Αυτοσωμική υπολειπόμενη ασθένεια. Ανεπάρκεια της αναπνευστικής αλυσίδας των μιτοχονδρίων. 2.2.Wilson ασθένεια Ασθένεια του μεταβολισμού του χαλκού. Ασθένεια του μεταβολισμού του χαλκού. Αυτοσωμική υπολειπόμενη ασθένεια. Ανεπάρκεια της αναπνευστικής αλυσίδας των μιτοχονδρίων. Αυτοσωμική υπολειπόμενη ασθένεια. Ανεπάρκεια της αναπνευστικής αλυσίδας των μιτοχονδρίων.

77 Μιτοχονδριακές ασθένειες 1. Χρόνια προοδευτική εξωτερική οφθαλμοπληγία (CPEO) – παράλυση των μυών που κινούν τους οφθαλμούς, πτώση. Έλλειψη του mtDNA. 2. Σύνδρομο Κearns-Sayre (KSS) – σποραδική με έναρξη πριν από την ηλικία των 20. Π ροοδευτική εξωτερική οφθαλμοπληγία, ανώμαλη χρώση της ίριδας, καρδιακή δυσλειτουργία, εγκεφαλική αταξία. Διαβήτης. Νεφρική ανεπάρκεια. Έλλειψη περιοχής του mtDNA. 3. Mυοκλωνική επιληψία (MERRF ) - επιληψία, αταξία εμφανιζόμενη σε παιδικά ηλικία ή εφηβεία. Μπορεί να εμφανισθούν απώλεια ακοής, άνοια, ατροφία οπτικού νεύρου. Στο 85% των περιπτώσεων μετάλλαξη αντικατάστασης βάσης στο tRNA-λυσίνη που οδηγεί σε βλάβες στα σύμπλοκα I και IV. Συνήθως ετεροπλασμία.

78 Μιτοχονδριακό γονιδίωμα

79 4. Mιτοχινδριακή εγκεφαλοπάθεια, οξέωση λακτικού και καρδιακά επεισόδια (MELAS). Δυσλειτουργία του εγκεφάλου (συνήθως επιληψία, παράλυση και άνοια) σε συνδυασμό με μιτοχονδριακή μυοπάθεια και οξέωση του αίματος. Σταδιακή εμφάνιση της ασθένειας, με τα πρώτα συμπτώματα να εμφανίζονται μεταξύ 5 και 15 ετών. Το 80% των ασθενών έχουν ετεροπλασμία. Αντικατάσταση στο tRNA – lλευκίνη, που οδηγεί σε έλλειψη των απαραίτητων πρωτεϊνών που κωδικοποιούνται από τα μιτοχόνδρια και διεξάγουν την οξειδωτική φωσφορυλίωση.

80 Μιτοχονδριακό γονιδίωμα

81 5. Leber’s κληρονομική οπτική νευροπάθεια (LHON) Ξαφνική απώλεια της όρασης γύρω στην ηλικία των 20 ετών. Διάφορες μεταλλάξεις κωδικονίων λήξης στο γονίδιο που κωδικοποιεί την πρωτεΐνη ND4. Η ND4 είναι μια από τις υπομονάδες που βρίσκονται στο σύμπλοκο I, που καταλύει τη μεταφορά ηλεκτρονίων από το NADH στο συνένζυμο Q. Ατροφία του οπτικού νεύρου, διαταραχές της κίνησης. Συνήθως ομοπλασμία. 6. Νευρογενής μυϊκή αδυναμία, αταξία, αμφιβληστροειδοπάθεια (NARP). Απώλεια μυϊκής δύναμης και συντονισμού κινήσεων που συνοδεύεται από εκφύλιση εγκεφαλικών περιοχών και του αμφιβληστροειδούς.

82 Μιτοχονδριακό γονιδίωμα

83 7. Σύνδρομο Leigh’s. Προοδευτική απώλεια της κίνησης και της ομιλίας και εκφύλιση βασικών γαγγλίων-δυνητικά θνησιγόνος στην παιδική ηλικία. Έχουν περιγραφεί και μεταλλάξεις πυρηνικού DNA. 8. Σύνδρομο Pearson’s. Δυσλειτουργία του μυελού των οστών από την παιδική ηλικία και έκπτωση παγκρεατικής λειτουργίας. Ελλειψη/διπλασιασμός mtDNA. 9. Διαβήτης και κώφωση. 10. Μη συνδρομική κώφωση. Μη αντιστρεπτή κώφωση που σχετίζεται με τη λήψη αντιβιοτικών αμινογλυκοζιδίων (π.χ., στρεπτομυκίνη, γενταμυκίνη, καναμυκίνη). Τα αντιβιοτικά προσδένονται στο μεταλλαγμένο μιτοχονδριακό rRNA, εμπλέκονται στη μετάφραση μέσα στα μιτοχόνδρια και οδηγούν σε απώλεια της λειτουργίας των μιτοχονδρίων.


Κατέβασμα ppt "Μονογονιδιακές ασθένειες Βασιλική Αλεπόρου-Μαρίνου Αναπλ.Καθηγήτρια."

Παρόμοιες παρουσιάσεις


Διαφημίσεις Google