Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

 ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ  ΤΙΛΟΣ ΕΡΓΟΥ  ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ.

Παρόμοιες παρουσιάσεις


Παρουσίαση με θέμα: " ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ  ΤΙΛΟΣ ΕΡΓΟΥ  ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ."— Μεταγράφημα παρουσίασης:

1  ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ  ΤΙΛΟΣ ΕΡΓΟΥ  ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ ΚΥΡΙΑ ΕΡΕΥΝΗΤΙΚΗ ΟΜΑΔΑ Ζακυνθινός Γιώργος ΤΕΙ ΚΑΛΑΜΑΤΑΣ Κανάκης Ανδρέας ΤΕΙ ΚΑΛΑΜΑΤΑΣ Παπαδέλλη Μαρίνα ΤΕΙ ΚΑΛΑΜΑΤΑΣ Κίντζιος Σπυρίδων Γ.Π.Α. Λιονάκης Σπυρίδων ΤΕΙ ΚΡΗΤΗΣ/ΗΡΑΚΛΕΙΟ Παπλωμτάς Επαμεινώνδας Γ.Π.Α. Παπαδοπούλου Καλλιόπη ΤΕΙ ΚΑΛΑΜΑΤΑΣ/ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΔΕΥΤΕΡΕΥΟΥΣΑ ΕΡΕΥΝΗΤΙΚΗ ΟΜΑΔΑ ΞΑΡΧΑΚΟΥ ΧΡΙΣΤΙΝΑ - ΠΑΠΑΔΑΚΗΣ ΙΩΑΝΝΗΣ-ΤΣΕΚΑΣ ΣΩΤΗΡΗΣ- Μ. ΜΟΣΧΟΠΟΥΛΟΥ

2 Ο μικροπολλαπλασιασμός, η ανάπτυξη τεχνικής παραγωγής σωματικών εμβρύων ελληνικών ποικιλιών ελιάς με εμπορικό ενδιαφέρον, η ταυτοποίησής τους με μοριακές τεχνικές όπως και η ταυτοποίηση - διάγνωση του παθογόνου Verticillium sp μοριακά αποτέλεσαν τις βιοτεχνολογικές εφαρμογές του έργου αυτού που σκοπό είχαν την παραγωγή πιστοποιημένου πολλαπλασιαστικού υλικού ελιάς. Οι εργασίες του ερευνητικού έργου περιελάμβαναν τα παρακάτω πακέτα εργασίας. ΠΕ 1.Μικροπολλαπλασιασμός δέκα ποικιλιών ελιάς ΠΕ 2.Σωματική εμβρυογένεση και αναγέννηση φυτών σε δύο ποικιλίες ελιάς ΠΕ 3.Ταυτοποίηση δέκα ποικιλιών ελιάς με χρήση μοριακών δεικτών. ΠΕ 4.Ανάπτυξη πρωτοκόλλου ρουτίνας ανίχνευσης Verticillium sp. «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ»

3   ΠΕ 1 Μικροπολλαπλασιασμός δέκα ποικιλιών ελιάςΜεθοδολογία Κύριες δραστηριότητες του πακέτου εργασίας ήταν:  ΕΓΚΑΤΑΣΤΑΣΗ ΚΑΛ/ΓΕΙΑΣ IN VITRO.: Αφορούσε το φυτικό υλικό, τα χρησιμοποιούμενα υποστρώματα και την απολύμανση.  ΣΤΑΔΙΟ ΠΟΛΛΑΠΛΩΝ ΒΛΑΣΤΩΝ IN VITRO: Στο στάδιο αυτό ερευνήθηκαν τρία επώνυμα διαλύματα η συκέντρωση κυτοκινινών και αυξινών, η χρησιμοποίηση διαφόρων τύπων δοχείων.  ΡΙΖΟΒΟΛΙΑ IN VITRO:.μελετήθηκε η ικανότητα προς ριζοβολία των βλαστών χρησιμοποιώντας τα βασικά υποστρώματα.  ΣΚΛΗΡΑΓΩΓΗΣΗ ΤΩΝ ΦΥΤΩΝ :Τα φυτάρια ριζοβόλησαν φυτεύτηκαν στο θερμοκήπιο ακολουθώντας γνωστά πρωτόκολλα σκληραγώγησης.

4 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» Εγκατάσταση

5 ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ»  Πολλαπλοί Βλαστοί

6 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ»  Ριζοβολία

7 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» Σωματική εμβρυογένεση σε δύο ποικιλίες ελιάς Μεθοδολογία Μεθοδολογία Στόχος του παρόντος πακέτου εργασίας ήταν:  ΕΓΚΑΤΑΣΤΑΣΗ ΚΑΛΛΙΕΡΓΕΙΑΣ IN VITRO : Δοκιμάστηκε φυτικό υλικό το οποίο προήλθε από διάφορες πηγές και εξετάσθηκε η δυνατότητα της εμβρυογένεσης  ΣΧΗΜΑΤΙΣΜΟΣ ΣΩΜΑΤΙΚΩΝ ΕΜΒΡΥΩΝ: Αφορούσε δοκιμές διαφόρων φυτορρυθμιστών ανάπτυξης στην εμβρυογένεση, το χρησιμοποιούμενο υπόστρωμα,  ΦΥΤΡΩΣΗ-ΑΡΧΙΚΗ ΑΝΑΠΤΥΞΗ ΤΩΝ ΕΜΒΡΥΩΝ: Τα σχηματισμένα από το προηγούμενο στάδιο έμβρυα θα μεταφέρθηκαν σε νέα υποστρώματα με διαφοροποίηση ορμονών  ΑΝΑΠΤΥΞΗ ΦΥΤΑΡΙΩΝ ΑΠΟ ΑΝΕΠΤΥΓΜΕΝΑ ΣΩΜΑΤΙΚΑ ΕΜΒΡΥΑ: Τα φυτρωμένα σωματικά έμβρυα μεταφέρθηκαν σε υπόστρωματα ελεύθερα ορμονών

8 Εικόνα 1: Πηγές εκφύτων και έκφυτα Εικόνα 2: Πηγές εκφύτων και έκφυτα ποικιλίας «Καλαμών » ποικιλίας «Κορωνέϊκης» «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» Σωματική εμβρυογένεση σε δύο ποικιλίες ελιάς Πηγή & είδος εκφύτου Στα έκφυτα της ποικιλίας «Κορωνέικης» μορφογενετική αλλαγή παρατηρήθηκε σε μεγαλύτερο ποσοστό κυρίως σε έκφυτα τμήματος βλαστού ενώ στη Καλαμών παρατηρήθηκε ότι έκφυτα προερχόμενα από τμήμα φύλλου με μίσχο έδωσαν ανάλογα αποτελέσματα.

9 Σωματική εμβρυογένεση σε δύο ποικιλίες ελιάς «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» Σωματική εμβρυογένεση σε δύο ποικιλίες ελιάς ΕΜΒΡΥΑ ΕΓΚΑΤΑΣΤΑΣΗ ΚΑΛΛΙΕΡΓΕΙΑΣ IN VITRO : ΕΜΒΡΥΑ ΕΓΚΑΤΑΣΤΑΣΗ ΚΑΛΛΙΕΡΓΕΙΑΣ IN VITRO : ΣΧΗΜΑΤΙΣΜΟΣ ΣΩΜΑΤΙΚΩΝ ΕΜΒΡΥΩΝ: ΣΧΗΜΑΤΙΣΜΟΣ ΣΩΜΑΤΙΚΩΝ ΕΜΒΡΥΩΝ: ΦΥΤΡΩΣΗ-ΑΡΧΙΚΗ ΑΝΑΠΤΥΞΗ ΤΩΝ ΕΜΒΡΥΩΝ: ΦΥΤΡΩΣΗ-ΑΡΧΙΚΗ ΑΝΑΠΤΥΞΗ ΤΩΝ ΕΜΒΡΥΩΝ: ΑΝΑΠΤΥΞΗ ΦΥΤΑΡΙΩΝ ΑΠΟ ΑΝΕΠΤΥΓΜΕΝΑ ΣΩΜΑΤΙΚΑ : ΑΝΑΠΤΥΞΗ ΦΥΤΑΡΙΩΝ ΑΠΟ ΑΝΕΠΤΥΓΜΕΝΑ ΣΩΜΑΤΙΚΑ :

10 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» Ταυτοποίηση δέκα (10) ποικιλιών ελιάς με χρήση μοριακών δεικτών. Μεθοδολογία Το φυτικό υλικό που που χρησιμοποιήθηκε προήλθε τόσο απο φυτώρια όσο και απο κτήματα ΑΠΟΜΟΝΩΣΗ DNA ΑΠΌ ΤΙΣ ΔΕΚΑ (10) ΠΟΙΚΙΛΙΕΣ: Απομόνωση DNA και έλεγχος καθαρότητας αυτού ηλεκτροφορετιές τεχνικές. ΣΧΕΔΙΑΣΜΟΣ ΕΚΚΙΝΗΤΩΝ: Σχεδίαση και αξιολόγηση εκκινητών ΧΡΗΣΗ ΕΠΙΛΕΓΜΕΝΩΝ ΕΚΚΙΝΗΤΩΝ ΣΤΗΝ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΤΗΣ ΠΟΛΥΜΕΡΑΣΗΣ : Οι εκκινητές επιλέγηκαν από το προηγούμενο στάδιο και χρησιμοποιήθηκαν για την εφαρμογή PCR στις δέκα ποικιλίες. ΔΗΜΙΟΥΡΓΙΑ ΔΕΝΔΡΟΓΡΑΜΜΑΤΩΝ ΣΥΓΓΕΝΕΙΑΣ: Με τη βοήθεια λογισμικού ανάλυσης της ηλεκτροφόρησης προέκυψαν αντίστοιχα δενδρογράμματα

11 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» ταυτοποίηση δέκα (10) ποικιλιών ελιάς με χρήση μοριακών δεικτών. ΑΠΟΜΟΝΩΣΗ DNA ΑΠΌ ΤΙΣ ΔΕΚΑ (10) ΠΟΙΚΙΛΙΕΣ: Απομόνωση DNA και έλεγχος καθαρότητας.

12 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» ταυτοποίηση δέκα (10) ποικιλιών ελιάς με χρήση μοριακών δεικτών.  Αλληλουχίες εκκινητών  Elia235 αλληλουχία 5’GGACTGGAGT-3’  Elia489 αλληλουχία 5’CCACAGCAGT-3’  Elia 678 αλληλουχία 5’TGCGGGGTTC-3’

13 Δ1Δ2Δ3Δ4Δ5Δ6Δ7Δ8Δ9Δ10Δ11Δ12Δ13Δ14Δ15Δ16Δ17Δ18 Δ1 9 Δ20 Ο πολυμορφισμός σε 20 δείγματα ποκιλιών ελιάς που αναπτύχθηκε χρησιμοποιώντας την αλληλουχία 5’CCACAGCAGT-3’του εκκινητή Elia489

14 Δ1Δ2Δ3Δ4Δ5Δ6Δ7Δ8Δ9Δ10Δ11Δ12Δ13Δ14Δ15Δ16Δ17Δ18 Δ1 9 Δ20 Μέσα από τη μελέτη της γενετικής απόστασης προέκυψε μια διαφοροποίηση όσο αφορά την συγγένεια των ποικιλιών Αμφίσσης Αμυδγαλολιά Θρουμπολιά Καλαμων Κοθρέικη Κορωνεικη Μεγάρων Μαστοειδής Χαλκιδικής Άμφισσας Θρουμπολιά Μαστοειδής Κοθρέικη Χαλκιδικής Καλαμών Κορωνεικη ΑμυγδαλολιάΜεγάρων

15 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ» ΑΝΑΠΤΥΞΗ ΠΡΩΤΟΚΟΛΛΟΥ ΑΝΙΧΝΕΥΣΗΣ- ΔΙΑΓΝΩΣΗΣ TOY Verticillium sp ΜΕΘΟΔΟΛΟΓΙΑ Όλες οι εργασίες του πακέτου εργασίας αυτού ήταν να παραχθεί μια αξιόπιστη και με επαναληψιμότητα διαγνωστική τεχνική για γρήγορη και έγκαιρη διάγνωση του παθογόνου σε φυτωριακό υλικό ελιάς.Η ομάδα εργασίας ασχολήθηκε με την απλούστευση και την σηντόμευση των διαγνωστικών διαδικασιών του παθογόνου χωρίς να χάνει σε αξιοπιστία και επαναληψιμότητα.Η εργασία στηρίχθηκε κυρίοως στο να είναι απ μονώσιμο το παθογόνο τόσο στο χώμα όσο και στο δενδρύλιο.Για αυτό ‘ολη εργασία στήθηκε ώστε να βρεθούν οι καταλληλότεροι και συνδιασμένα εκκινητές Όλες οι εργασίες του πακέτου εργασίας αυτού ήταν να παραχθεί μια αξιόπιστη και με επαναληψιμότητα διαγνωστική τεχνική για γρήγορη και έγκαιρη διάγνωση του παθογόνου σε φυτωριακό υλικό ελιάς.Η ομάδα εργασίας ασχολήθηκε με την απλούστευση και την σηντόμευση των διαγνωστικών διαδικασιών του παθογόνου χωρίς να χάνει σε αξιοπιστία και επαναληψιμότητα.Η εργασία στηρίχθηκε κυρίοως στο να είναι απ μονώσιμο το παθογόνο τόσο στο χώμα όσο και στο δενδρύλιο.Για αυτό ‘ολη εργασία στήθηκε ώστε να βρεθούν οι καταλληλότεροι και συνδιασμένα εκκινητές ΠΡΩΤΟΚΟΛΛΟ ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΤΟΝ ΞΥΛΩΔΗ ΦΥΤΙΚΟ ΙΣΤΟ ΠΡΩΤΟΚΟΛΛΟ ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΠΑΘΟΓΟΝΟ ΠΡΩΤΟΚΟΛΛΟ ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΤΟΝ ΞΥΛΩΔΗ ΦΥΤΙΚΟ ΙΣΤΟ ΠΡΩΤΟΚΟΛΛΟ ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΠΑΘΟΓΟΝΟ

16 «ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ»  ΕΚΚΙΝΗΤΕΣ Targen organismGene targetPrimerSequence (5´-3´)Length (bp)Accession.ITS2- FCCGCCGGTCCATCAGTCTCTCTGTTTATAC…… NoVerticillium dahliae5.8S ribosomal RNAITS1- RCGCCTGCGGGACTCCGATGCGAGCTGTAAC347Z29511 ….………. NoVerticillium dahliae5.8S ribosomal RNAITS1- RCGCCTGCGGGACTCCGATGCGAGCTGTAAC347Z29511 ….………. ΑΝΑΠΤΥΞΗ ΠΡΩΤΟΚΟΛΛΟΥ ΑΝΙΧΝΕΥΣΗΣ- ΔΙΑΓΝΩΣΗΣ TOY Verticillium sp

17 ΟΙΚΟΝΟΜΙΚΟ ΑΝΤΙΚΕΙΜΕΝΟ  ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ  ΤΙΛΟΣ ΕΡΓΟΥ  ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ

18 Οικονομικό αντικείμενο έργου ανά επιλέξιμη δαπάνη Κωδικός Δαπάνης ΠεριγραφήΕπιλέξιμος Π/Υ Δηλωθείσες Δαπάνες % Απορρόφη σης Καταλογισμοί υποέργων Καταλογισμοί έργων Γ60.00 ΑΜΟΙΒΕΣ ΕΜΜΙΣΘΟΥ ΠΡΟΣΩΠΙΚΟΥ ,66 -- Γ61.00 ΑΜΟΙΒΕΣ ΚΑΙ ΕΞΟΔΑ ΕΛΕΥΘΕΡΩΝ ΕΠΑΓΓ/ΤΙΩΝ ΥΠΟΚΕΙΜΕΝΩ Ν ΣΕ ΦΟΡΟ Γ61.01 ΑΜΟΙΒΕΣ ΚΑΙ ΕΞΟΔΑ ΜΗ ΕΛΕΥΘΕΡΩΝ ΕΠΑΓΓ/ΤΙΩΝ ΥΠΟΚΕΙΜ.ΣΕ ΦΟΡΟ ,95 -- Γ64.01ΕΞΟΔΑ ΤΑΞΙΔΙΩΝ ,194,14 -- Γ64.02 ΕΞΟΔΑ ΠΡΟΒΟΛΗΣ ΚΑΙ ΔΙΑΦΗΜΙΣΗΣ ,825,37 -- Γ64.07 ΕΝΤΥΠΑ ΚΑΙ ΓΡΑΦΙΚΗ ΥΛΗ ,84 -- Γ64.08 ΥΛΙΚΑ ΑΜΕΣΗΣ ΑΝΑΛΩΣΗΣ ,2997,56 -- Γ64.98ΔΙΑΦΟΡΑ ΕΞΟΔΑ Γ66.04 ΑΠΟΣΒΕΣΕΙΣ ΕΠΙΠΛΩΝ ΚΑΙ ΛΟΙΠΟΥ ΕΞΟΠΛΙΣΜΟΥ ,7584,19 -- Σύνολα ,9488,0300

19 Οικονομικό αντικείμενο έργου ανά υποέργο Υποέργα από:1 έως:2 Κωδικός Τίτλος υποέργου AA Νομι κής Δέσμ ευση ς Π/Υ ΥποέργουΔηλωθείσες Δαπάνες % Απορ ρόφη σης Καταλογισμ οί Υποέ ργων Καταλογισμ οί Έργω ν ΕπιλέξιμοςΣυνολικός Δημόσια Δαπά νη Συνολικές 1 ΒΙΟΤΕΧΝΟΛΟΓ ΙΚΕΣ ΕΦΑΡΜΟ ΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓ Η ΠΟΛΛΑΠ ΛΑΣΙΑΣΤΙ ΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚ ΩΝ ΠΟΙΚΙΛΙΏ Ν ΕΛΙΑΣ ,14 91, ΚΕΝΤΡΙΚΕΣ ΔΡΑΣΕΙΣ ,8 52,660- Σύνολα ,94 88,0300

20 Στοιχεία Ποιοτικών και ποσοτικών Δεικτών Απασχόληση Πλήρη 36 ανθρωπομήνες Μερική 49 ανθρωπομήνες Άνδρες 7 Γυναίκες 4 Δημοσιότητα Ημερίδες 2 Δημοσιεύσεις 4 ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ ΤΙΛΟΣ ΕΡΓΟΥ ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΕΛΙΑΣ ΤΕΙ ΚΑΛΑΜΑΤΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ

21 ΕΥΧΑΡΙΣΤΩ ΟΛΟΥΣ ΟΣΟΥΣ ΣΥΝΤΕΛΕΣΑΝ ΣΤΗΝ ΕΚΠΟΝΗΣΗ ΑΥΤΟΥ ΤΟΥ ΕΡΓΟΥ ΤΟ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΤΗ ΥΔ ΕΠΕΑΕΚ ΤΟ ΤΕΙ ΚΑΛΑΜΑΤΑΣ ΤΟΥΣ ΣΥΝΑΔΕΛΦΟΥΣ ΚΑΙ ΣΥΝΕΡΓΑΤΕΣ ΙΔΙΑΙΤΕΡΑ ΤΑ ΜΕΛΗ ΤΗΣ ΔΕΥΤΕΡΕΥΟΥΣΑΣ ΕΡΕΥΝΗΤΙΚΗΣ ΟΜΑΔΑΣ ΚΑΙ ΦΥΣΙΚΑ ΤΟΥΣ ΑΓΑΠΗΤΟΥΣ ΠΡΟΣΚΕΚΛΗΜΕΝΟΥΣ ΓΙΑ ΤΗΝ ΠΡΟΣΟΧΗ ΤΟΥΣ


Κατέβασμα ppt " ΕΠΕΑΕΚ /ΠΡΟΓΡΑΜΜΑ ΑΡΧΙΜΗΔΗΣ ΙΙ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΑΤΕΙ  ΤΙΛΟΣ ΕΡΓΟΥ  ΒΙΟΤΕΧΝΟΛΟΓΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΠΟΛΛΑΠΛΑΣΙΑΣΤΙΚΟΥ ΥΛΙΚΟΥ ΕΛΛΗΝΙΚΩΝ."

Παρόμοιες παρουσιάσεις


Διαφημίσεις Google