Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Η παρουσίαση φορτώνεται. Παρακαλείστε να περιμένετε

Τεχνικές Μοριακής Βιολογίας για τη Διάγνωση και Παρακολούθηση Λοιμωδών Νοσημάτων Έφη Πετεινάκη 1,2 1 Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Πανεπιστημίου.

Παρόμοιες παρουσιάσεις


Παρουσίαση με θέμα: "Τεχνικές Μοριακής Βιολογίας για τη Διάγνωση και Παρακολούθηση Λοιμωδών Νοσημάτων Έφη Πετεινάκη 1,2 1 Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Πανεπιστημίου."— Μεταγράφημα παρουσίασης:

1 Τεχνικές Μοριακής Βιολογίας για τη Διάγνωση και Παρακολούθηση Λοιμωδών Νοσημάτων Έφη Πετεινάκη 1,2 1 Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας 2 Εργαστήριο Μοριακής Μικροβιολογίας, Ινστιτούτο Βιο-Ιατρικής Έρευνας και Τεχνολογίας Λάρισας ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ, ΙΑΝΟΥΑΡΙΟΥ 2008 ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ, ΙΑΝΟΥΑΡΙΟΥ 2008

2 Ο ΡΟΛΟΣ ΤΟΥ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ΕΙΝΑΙ Η ΓΡΗΓΟΡΗ ΚΑΙ ΑΞΙΟΠΙΣΤΗ ΤΑΥΤΟΠΟΙΗΣΗ ΤΟΥ ΛΟΙΜΟΓΟΝΟΥ ΠΑΡΑΓΟΝΤΑ Ο ΡΟΛΟΣ ΤΟΥ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ΕΙΝΑΙ Η ΓΡΗΓΟΡΗ ΚΑΙ ΑΞΙΟΠΙΣΤΗ ΤΑΥΤΟΠΟΙΗΣΗ ΤΟΥ ΛΟΙΜΟΓΟΝΟΥ ΠΑΡΑΓΟΝΤΑ

3 ΣΤΟΧΟΙ  Έναρξη αιτιολογικής θεραπείας  Λήψη κατάλληλων μέτρων πρόληψης της διασποράς του λοιμογόνου παράγοντα

4 ΔΙΑΓΝΩΣΗ ΤΗΣ ΛΟΙΜΩΞΗΣ ΔΙΑΓΝΩΣΗ ΤΗΣ ΛΟΙΜΩΞΗΣ  άμεση μικροσκόπηση του παθολογικού υλικού (πυοσφαίρια-μικροοργανισμοί)  απομόνωση του μικροοργανισμού σε καθαρό καλλιέργεια  ταυτοποίηση βάσει φαινοτυπικών και βιοχημικών χαρακτήρων  έλεγχος της ευαισθησίας του μικροοργανισμού (ΑΝΤΙΒΙΟΓΡΑΜΜΑ)

5 ΜΙΚΡΟΣΚΟΠΗΣΗ  Περιορισμένη ειδικότητα και ευαισθησία  Παρουσία μεγάλου αριθμού μικροβίων (10.000/mL βιολογικού υγρού)  Δυσχερής η μορφολογική αναγνώριση  Εμπειρία

6 ΠΕΡΙΟΡΙΣΜΟΙ ΤΗΣ ΚΑΛΛΙΕΡΓΕΙΑΣ  Δυσκολίες στην απομόνωση μικροοργανισμών οι οποίοι αναπτύσσονται δύσκολα (Mycobacterium tuberculosis, Kingella κλπ)  Αδυναμία απομόνωσης του παθογόνου αίτιου λόγω χορήγησης αντιμικροβιακής θεραπείας  Αδυναμία διάγνωσης ιογενών λοιμώξεων

7 ΟΡΟΛΟΓΙΚΗ ΔΙΑΓΝΩΣΗ  Η εισαγωγή των ορολογικών αντιδράσεων έδωσε λύση σε αρκετές αλλά όχι σε όλες τις περιπτώσεις αλλά όχι σε όλες τις περιπτώσεις  Εξαιρετική βοήθεια στη διάγνωση των ιογενών λοιμώξεων  Περιορισμοί

8 ΠΕΡΙΟΡΙΣΜΟΙ ΤΗΣ ΟΡΟΛΟΓΙΚΗΣ ΔΙΑΓΝΩΣΗΣ  Απουσία αντισωμάτων στην αρχική φάση της νόσου  Απαραίτητη η λήψη δύο δειγμάτων με διαφορά 15νθημέρου το ένα από το άλλο  Αδυναμία παραγωγής αντισωμάτων σε άτομα με ανοσοανεπάρκεια  Κατευθυνόμενη διάγνωση

9 Η εισαγωγή των μοριακών μεθόδων στην κλινική διαγνωστική Η εισαγωγή των μοριακών μεθόδων στην κλινική διαγνωστική έγινε κυρίως για να επιλυθούν οι αδυναμίες των συμβατικών μεθόδων, έτσι ώστε ο λοιμογόνος παράγων να ταυτοποιείται αξιόπιστα και γρήγορα

10 Σύγχρονο Κλινικό Μικροβιολογικό Εργαστήριο Σύγχρονο Κλινικό Μικροβιολογικό Εργαστήριο  εξοικείωση με τη χρήση των μοριακών τεχνικών  επιλογή και σχεδιασμός καταλληλότερης μεθοδολογίας, η οποία κατά κύριο λόγο εξαρτάται από το κλινικό δείγμα  εμπορικά kits, in house μέθοδοι  περιορισμός του κόστους, ασφάλεια

11 ΣΥΝΗΘΕΙΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΚΛΙΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ  η τεχνική της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR)  η τεχνική του υβριδισμού  η ηλεκτροφόρηση σε παλλόμενο ηλεκτρικό πεδίο (PFGE)

12 Επιλογή Μεθοδολογίας  Αλυσιδωτή αντίδραση πολυμεράσης  Υβριδισμός στην ανίχνευση γενετικού μικροβιακού υλικού στην ανίχνευση γενετικού μικροβιακού υλικού ΔΙΑΓΝΩΣΗ ΛΟΙΜΩΞΗΣ ΔΙΑΓΝΩΣΗ ΛΟΙΜΩΞΗΣ  Ηλεκτροφόρηση σε παλλόμενο ηλεκτρικό πεδίο σύγκριση της γενετικής ομοιότητας ανάμεσα σε μικροοργανισμούς σύγκριση της γενετικής ομοιότητας ανάμεσα σε μικροοργανισμούς ΠΡΟΛΗΨΗ ΔΙΑΣΠΟΡΑΣ ΤΩΝ ΛΟΙΜΩΞΕΩΝ ΠΡΟΛΗΨΗ ΔΙΑΣΠΟΡΑΣ ΤΩΝ ΛΟΙΜΩΞΕΩΝ

13 Βασικές αρχές της PCR Πολλαπλασιασμός ενός επιλεγμένου τμήματος μικροβιακού DNA Χρησιμοποιείται ένα ζεύγος εκκινητών (primers),που έχουν συμπληρωματική αλληλουχία με τα άκρα του DNA-στόχου Ο κάθε κύκλος της PCR περιλαμβάνει στάδια 1. Αποδιάταξη του DNA στόχου (θέρμανση 94-95οC) 2. Σύνδεση των εκκινητών στα άκρα του DNA-στόχου 3. Επέκταση των συμπληρωματικών αλυσίδων, με τη βοήθεια του ενζύμου Taq-πολυμεράση βοήθεια του ενζύμου Taq-πολυμεράση

14

15 Αρχή της PCR Θεωρητικά από 1 αντίγραφο DNA μπορεί να παραχθούν εκατομμύρια αντίγραφα Χρησιμοποιείται σε δείγματα για ανίχνευση-χαρακτηρισμό γενετικού μικροβιακού υλικού  Υψηλή ευαισθησία  Χαμηλότερη ειδικότητα

16 Βασικές αρχές του υβριδισμού Ομοιότητα του βακτηριακού DNA με την αλληλουχία του ιχνηθέτη που έχουμε επιλέξει Η πρόσδεση του βακτηριακού DNA με τον ιχνηθέτη ανιχνεύεται με διάφορους τρόπους

17  Χρησιμοποιείται για ανίχνευση- χαρακτηρισμό γενετικού μικροβιακού υλικού  Εξαιρετική ειδικότητα  Υπολείπεται σε ευαισθησία σε σχέση με την PCR

18 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΤΗΣ ΗΛΕΚΤΡΟΦΟΡΗΣΗΣ ΣΕ ΠΑΛΛΟΜΕΝΟ ΗΛΕΚΤΡΙΚΟ ΠΕΔΙΟ (PFGE)  Πέψη με ειδικές ενδονουκλεάσες  Ηλεκτροφόρηση  Σύγκριση

19 Παράδειγμα 2 στελέχη S. aureus …gatgcatggcatt/gtttgcattgcattttggtaaacct agatt…. ….gatgctgcggatgccgcatttt/gtttgcattgcatttt ggtaaacct……

20

21 ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ 1.Άμεσα στο κλινικό δείγμα (4h)  ανίχνευση-ταυτοποίηση του μικροοργανισμού  ανίχνευση γονιδίων αντοχής και γονιδίων παθογονικότητας παθογονικότητας

22 ΠΛΕΟΝΕΚΤΗΜΑΤΑ  Ανίχνευση ιών, χλαμμυδίων κλπ  Εφαρμογή αιτιολογικής θεραπείας  Λήψη μέτρων πρόληψης Μεθοδολογία: PCR, υβριδισμός

23 ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ 2. Μοριακή ταυτοποίηση του μικροοργανισμού από καθαρό καλλιέργημα εφαρμογή στην ταυτοποίηση των εφαρμογή στην ταυτοποίηση των μυκοβακτηριδίων κλπ μυκοβακτηριδίων κλπ Μεθοδολογία: PCR-υβριδισμός

24 ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ 3. Διερεύνηση ενδο-νοσοκομειακών λοιμώξεων Διασπορά από ασθενή σε ασθενή με σκοπό τη λήψη μέτρων πρόληψης Μεθοδολογία: PFGE

25 ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ 4. Διερεύνηση των μηχανισμών αντοχής  αδυναμία των φαινοτυπικών μεθόδων Παράδειγμα: στελέχη S. aureus mecA(+) με ενδιάμεση αντοχή στα β-λακταμικά αντιβιοτικά Μεθοδολογία: PCR, etc

26 ΕΦΑΡΜΟΓΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗΝ ΚΛΙΝΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ 5. Κατανόηση της παθογένειας των λοιμώξεων π.χ. υποτροπιάζουσα φαρυγγοαμυγδαλίτιδα, υποτρπές ορθοπαιδικών λοιμώξεων υποτρπές ορθοπαιδικών λοιμώξεων (ενδοκυττάρια μικρόβια)

27 MOΡΙΑΚΗ ΔΙΑΓΝΩΣΤΙΚΗ ΤΩΝ ΛΟΙΜΩΞΕΩΝ ΜΥΘΟΣή ΠΡΑΓΜΑΤΙΚΟΤΗΤΑ ???

28 Ερωτήματα  Εφαρμογή στο εργαστήριο ρουτίνας και σε ποιες περιπτώσεις ??? περιπτώσεις ???  Κόστος??  Εμπορικά kits ή in house μέθοδοι??

29 Άμεση ανίχνευση του μικροοργανισμού στο κλινικό δείγμα  ανίχνευση ιών (ιός ηπατίτιδας, ΑIDS)  απάντηση σε συντομότερο διάστημα (π.χ. Mycobacterium tuberculosis)  ανεξάρτητη από προηγηθείσα αντιμικροβιακή θεραπεία

30 Διάγνωση ιογενούς λοιμώξεως  Προσδιορισμός ιικού φορτίου (Real- time PCR)  Προσδιορισμός μεταλλάξεων που σχετίζονται με αντοχή σε αντι-ικά φάρμακα

31 Ταχεία-αξιόπιστη διάγνωση φυματίωσης Ταχεία-αξιόπιστη διάγνωση φυματίωσης  Είναι απαραίτητη λόγω - αναγκαιότητα έναρξης θεραπευτικής αγωγής - αναγκαιότητα έναρξης θεραπευτικής αγωγής - απομόνωσης του ασθενούς (  stop transmission) - απομόνωσης του ασθενούς (  stop transmission) - έναρξη προφυλακτικής αγωγής στο οικείο - έναρξη προφυλακτικής αγωγής στο οικείο περιβάλλον ( prevent disease) περιβάλλον ( prevent disease) σήμερα: συχνότητα νόσου σήμερα: συχνότητα νόσου -  πολυανθεκτικών TB (MDR-TB) ( R to INH and RIF) -  πολυανθεκτικών TB (MDR-TB) ( R to INH and RIF)

32 Ερωτηματικά στη ΤΒ διάγνωση βάσει ΖΝ  Είναι μυκοβακτηρίδιο?  Αν ναι, είναι μυκοβακτηρίδιο φυματίωσης?  Αν ναι, είναι ευαίσθητο?  Αν ανήκει στα ΝΤΜ, ποιο είδος είναι και ποια η κλινική του σημασία?

33 Συνδυασμός κλασσικών και μοριακών τεχνικών-2007  ΖΝ χρώση  Καλλιέργεια-απομόνωση-ταυτοποίηση- έλεγχος ευαισθησίας (14+10 ημέρες)  Άμεση ανίχνευση γενετικού υλικού μυκοβακτηριδίου στο κλινικό δείγμα

34 ΜΕΘΟΔΟΛΟΓΙΑ Εμπορικά kits (18-50 € /test) Εμπορικά kits (18-50 € /test) (1) LCx MT Assay (Abbott)  Gap Ligase Chain Reaction, target: DNA (Protein Antigen B)  the cheapest test (2) Amplified MT Direct Test (Gen-Probe, Biomerieux)  Transcription - Mediated Amplification, target: rRNA (2x10 3 copies)  the most sensitive test (3) Amplicor MTB PCR (Roche)  Polymerase Chain Reaction, target: DNA (16S rRNA)  detection of inhibition (4) BDProbeTec ET (Becton Dickinson)  Strand Displacement Amplification, target: DNA (IS6110; 8-25 copies)  TAT: 1 hour (!!!), detection of inhibition ΜΟΝΟ ΓΙΑ ΔΕΙΜΑΤΑ ΤΟΥ ΑΝΑΜΝΕΥΣΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΜΟΝΟ ΓΙΑ ΔΕΙΜΑΤΑ ΤΟΥ ΑΝΑΜΝΕΥΣΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ

35 Εφαρμογή μοριακών τεχνικών σε βρογχικές εκκρίσεις και πτύελα για ανίχνευση DNA Mycobacterium spp  ποικιλία μοριακών τεχνικών με δυνατότητα ανίχνευσης- ταυτοποίησης σε επίπεδο είδους  εξαρτάται η ευαισθησία της μεθόδου από την ποιότητα του υλικού (περισσότερα από ένα δείγματα)  Δεν ενδείκνυται για παρακολούθηση ασθενών που βρίσκονται υπό αντιφυματική αγωγή

36 Ανίχνευση μεταλλάξεων που σχετίζονται με αντοχή σε ΙΝΗ- RIF Ανίχνευση της RIF-R  90.9% ευαισθησία Ανίχνευση της INH-R  94.4% ευαισθησία [Genotype MTBDR] Συνδυασμός PCR + υβριδισμού μέσα σε 4 ώρες

37

38 PCR απευθείας σε ΕΝΥ για ανίχνευση μικροβιακού DNA ( 4 ώρες) PCR απευθείας σε ΕΝΥ για ανίχνευση μικροβιακού DNA ( 4 ώρες) Διάγνωση PCR σε ΕΝΥ κ/α ΕΝΥ Διάγνωση PCR σε ΕΝΥ κ/α ΕΝΥ 48 (-) 48 (-) 48 (-) 48 (-) μηνιγγίτιδα 12 (+) 8 (+) μηνιγγίτιδα 12 (+) 8 (+) S. pneumoniae, N. meningitidis, H. influenzae type b Εξαρτάται η ευαισθησία της PCR στο αίμα από τον αριθμό των μικροβιακών κυττάρων

39  Περιορισμοί της κλασσικής PCR (επιλογή εκκινητών)  Aνάγκη εισαγωγής της 16S rRNA PCR  Eκκινητές κοινοί για όλα τα βακτηριακά είδη

40 Εισαγωγή της ευρέως φάσματος 16S rRNA PCR στη διάγνωση των λοιμώξεων Εισαγωγή της ευρέως φάσματος 16S rRNA PCR στη διάγνωση των λοιμώξεων  μεγάλο φάσμα μικροοργανισμών  ταυτοποίηση αξιόπιστη σε επίπεδο είδους  χαρακτηρισμός νέων παθογόνων  δυνατότητα ανίχνευσης περισσότερων από ένα είδη μικροοργανισμών  δυνατότητα εφαρμογής στο εργαστήριο ρουτίνας  ΕΝΥ, πλευριτικό, αρθρικό, ιστοί, αίμα κλπ

41 Συνδυασμός μοριακών και συμβατικών μεθόδων  Αίμα  Υγρά (περιτοναικό, πλευριτικό, ΕΝΥ, αρθρικό) αρθρικό)  Πτύελα-Βρογχικές εκκρίσεις  Ιστοί (ορθοπαιδικές λοιμώξεις, κλπ)

42 Παράλληλα με την κλασσική καλλιέργεια πρώτο στάδιο (απάντηση σε 4 h)  Απομόνωση DNA από το δείγμα (32 ασθενείς)  Έλεγχος καταλληλότητας του DNA ( ύπαρξη DNA, απουσία αναστολέων)  Χρησιμοποιείται ζεύγος εκκινητών κοινών για όλα τα μικρόβια (16S rRNA)  Ύπαρξη ή όχι μικροβιακού DNA  Αδυναμία ταυτοποίησης σε επίπεδο γένους και είδους

43 Προιόντα PCR μετά από πολλαπλασιασμό του 16S rRNA διαφόρων βακτηρίων. Γραμμή 1: μάρτυρας μοριακών βαρών, 2: Staphylococcus spp, 3: E. Coli, 4: Klebsiella spp, 5: Enterococcus spp, 6: S. pneumoniae, 7: Streptococcus spp, 8: Pseudomonas spp, 9: αρνητικός μάρτυρας Προιόντα PCR μετά από πολλαπλασιασμό του 16S rRNA διαφόρων βακτηρίων. Γραμμή 1: μάρτυρας μοριακών βαρών, 2: Staphylococcus spp, 3: E. Coli, 4: Klebsiella spp, 5: Enterococcus spp, 6: S. pneumoniae, 7: Streptococcus spp, 8: Pseudomonas spp, 9: αρνητικός μάρτυρας

44 Δεύτερο στάδιο- ταυτοποίηση Δεύτερο στάδιο- ταυτοποίηση  Μέθοδος υβριδισμού (ταινίες με DNA συγκεκριμένων μικροβίων)-απάντηση σε ώρες ή  Προσδιορισμός της νουκλεοτιδικής αλληλουχίας κατά Sanger κατά Sanger

45 ggaattactgggcgtaaagc gcacgcaggc ggttgcccaa ggaattactgggcgtaaagc gcacgcaggc ggttgcccaa gtcagatgtg aaagccccgg gcttaacctgg gaactgca ttgaaactgg gcgactagag tatgaaagag gaaagcgga gtcagatgtg aaagccccgg gcttaacctgg gaactgca ttgaaactgg gcgactagag tatgaaagag gaaagcgga atttccagtgt agcagtgaaa tgcgtagata ttggaaggaa caccgatggc gaaggcagct ttctgggtcg atactgacgc tcatgtgcga aagcgtgggg agcaaacagg attagatacc ctggtagtcc acgccctaaa cgatgtcaac taggcgtcgg gttgttaaag actcggtgcc ggagctaacg cattaagttg accgcctggg gagtacggcc gcaaggttga aactcaaaga aattgacggg gacccgcaca agcggtggag catgtggttt aattcgatgc aacgcgaaga accttaccag gccttgacat cctaggaact tggcagagat gccttggtgc cttcgggaac ctagagacag gtgttgcatg gctgtcgtca gctcgtgtcg atttccagtgt agcagtgaaa tgcgtagata ttggaaggaa caccgatggc gaaggcagct ttctgggtcg atactgacgc tcatgtgcga aagcgtgggg agcaaacagg attagatacc ctggtagtcc acgccctaaa cgatgtcaac taggcgtcgg gttgttaaag actcggtgcc ggagctaacg cattaagttg accgcctggg gagtacggcc gcaaggttga aactcaaaga aattgacggg gacccgcaca agcggtggag catgtggttt aattcgatgc aacgcgaaga accttaccag gccttgacat cctaggaact tggcagagat gccttggtgc cttcgggaac ctagagacag gtgttgcatg gctgtcgtca gctcgtgtcg

46 Προσδιορισμός της νουκλεοτιδικής αλληλουχίας  Ανάλυση κατά Sanger (sequencing)  Σύγκριση της συγκεκριμένης αλληλουχίας μέσω μιας τράπεζας BLAST-GENOME  Η ομοιότητα πρέπει να είναι πάνω από 97.5% για να είμαστε βέβαιοι ότι το βακτήριο ανήκει στο συγκεκριμένο γένος

47 Σύγκριση της αλληλουχίας  Cardiobacterium hominis 16S rRNA 100%

48 Ενδοκαρδίτιδα-PCR Ενδοκαρδίτιδα-PCR  Βακτηριαιμία είναι συνεχής  Αίμα ή καρδιακές βαλβίδες  Μικρόβια απαιτητικά, βραδέως αναπτυσσόμενα (ΗΑCEK) (ΗΑCEK)  Ανεπάρκεια της κλασσικής καλλιέργειας

49 Εμπειρία στο Πανεπιστημιακό Νοσοκομείο της Λάρισας Εμπειρία στο Πανεπιστημιακό Νοσοκομείο της Λάρισας  4 περιστατικά στη διάρκεια ενός έτους  ανίχνευση απευθείας σε αίμα  S. mitis, S. mutans, Cardiobacterium hominis, Βartonella quintana  ταχύτητα στη διάγνωση ( 17 ημέρες με την κλασσική καλλιέργεια) Petinaki et al, J Clin Microbiol 2006; 44: Petinaki et al, J Clin Microbiol 2006; 44:

50 PCR σε πλευριτικά-υγρά PCR σε πλευριτικά-υγρά  συχνά οι καλλιέργειες είναι στείρες  απαιτητικά μικρόβια  προηγούμενη αντι-μικροβιακή θεραπεία  Clostridium sordelii σε ασθενή με εμπύημα (4 προς 17 ημέρες) 17 ημέρες) Petinaki et al, Scand J infect Dis 65: 34-39, 2008 Petinaki et al, Scand J infect Dis 65: 34-39, 2008

51 PCR σε αρθρικά υγρά PCR σε αρθρικά υγρά Από 29 δείγματα, σε 3 ανιχνεύθηκε DNA Kingellae Από 29 δείγματα, σε 3 ανιχνεύθηκε DNA Kingellae kingae, 1 Streptococcus pneumoniae kingae, 1 Streptococcus pneumoniae Oι καλλιέργειες ήταν αρνητικές σε όλα τα Oι καλλιέργειες ήταν αρνητικές σε όλα τα δείγματα δείγματα

52 Απευθείας ανίχνευση μικροβιακού DNA σε αίμα ασθενών με PCR Απευθείας ανίχνευση μικροβιακού DNA σε αίμα ασθενών με PCR No PCR σε αίμα κ/α αίματος (-) 300 (-) (-) 300 (-) 26 9 (+) 26 (+) 26 9 (+) 26 (+) Ειδικότητα 100 % Ευαισθησία 34.61% Εξαρτάται η ευαισθησία της PCR στο αίμα από τον αριθμό των μικροβιακών κυττάρων

53 PCR σε ιστούς από ασθενείς με ορθοπαιδικές λοιμώξεις Χαμηλή ευαισθησία των κλασσικών μεθόδων λόγω  προηγούμενης αντι-μικροβιακής θεραπείας  κακής λήψης δείγματος  ανεπάρκεια του εργαστηρίου  δημιουργία βιομεμβράνης  μεικτή λοίμωξη, Alcanindiges illinoisensis, Comamonas terrigena, άγνωστα αναερόβια Raoult et al, J Clin Microbiol 2000, Raoult et al, J Clin Microbiol 2000,

54 Ορθοπαιδική Κλινική Πανεπιστημιακού Νοσοκομείου Λάρισας 2006 Ορθοπαιδική Κλινική Πανεπιστημιακού Νοσοκομείου Λάρισας ασθενείς Gram stain καλλιέργεια καλλιέργεια Παρουσία βακτηριακού DNA θετικά θετικά πυοσφαίριαΘετικά22Ασθενείς 52 52Ασθενείς αρνητικά πυοσφαίριαΑρνητικά30Ασθενείς

55 Ταυτοποίηση του μικροβιακού DNA 16 Escherichia coli ( 10 positive culture) 16 Escherichia coli ( 10 positive culture) 10 Staphylococcus aureus ( 5 positive culture) 10 Staphylococcus aureus ( 5 positive culture) 10 Staphylococcus epidermidis ( 5 positive culture) 10 Staphylococcus epidermidis ( 5 positive culture) 2 Enterococcus faecalis ( 1 positive culture) 2 Enterococcus faecalis ( 1 positive culture) 2 Streptococcus pneumoniae ( 1 positive culture) 2 Streptococcus pneumoniae ( 1 positive culture) 2 Streptococcus group B 2 Streptococcus group B 2 Streptococcus group A 2 Streptococcus group A 2 Pseudomonas aeruginosa 2 Pseudomonas aeruginosa 1 Bacteroides fragilis + Peptostreptococcus 1 Bacteroides fragilis + Peptostreptococcus 1 Fusobacterium 1 Fusobacterium 3 Kingella kingae 3 Kingella kingae 1 Eikenella corrodens 1 Eikenella corrodens

56 Παρουσία DNA στο κλινικό δείγμα κλινική σημασία  Νεκρά ή ζωντανά μικροβιακά κύτταρα  Έλεγχος βιωσιμότητας του μικροοργανισμού (εκχύλιση RNA από το κλινικό δείγμα, RT-PCR) (εκχύλιση RNA από το κλινικό δείγμα, RT-PCR)

57 Πανεπιστημιακό Νοσοκομείο Λάρισας ασθενείς Gram χρώση καλλιέργεια καλλιέργεια ‘Ελεγχος γιαπαρουσία μικροβιακού DNA βιωσιμότητα 30 ασθενείς πυοσφαίρι α αρνητική 30 ασθενείς 25 25ασθενείς

58 Η ΣΥΜΒΟΛΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΤΗΝ ΑΝΙΧΝΕΥΣΗ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΑΝΤΟΧΗΣ ΗΤΑΝ ΚΑΘΟΡΙΣΤΙΚΗ η εξάπλωση της μικροβιακής αντοχής επέβαλλε τη διερεύνηση σε μοριακό πλέον επίπεδο των μηχανισμών που ευθύνονται ανίχνευση γονιδίων απευθείας στο κλινικό δείγμα

59 Η ΣΥΜΒΟΛΗ ΤΩΝ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΤΗΝ ΑΝΙΧΝΕΥΣΗ ΠΑΡΑΓΟΝΤΩΝ ΠΑΘΟΓΟΝΙΚΟΤΗΤΑΣ  Panton-Valentin leukocidin gene  TSST-1  Γονιδίων που εμπλέκονται στην παραγωγή βιομεμβράνης

60 Η εξάπλωση στο νοσοκομειακό Η εξάπλωση στο νοσοκομειακό περιβάλλον περιβάλλον πολυανθεκτικών μικροοργανισμών επέβαλλε τη τυποποίηση αυτών πολυανθεκτικών μικροοργανισμών επέβαλλε τη τυποποίηση αυτών ( στελέχη που συνδέονται κλωνικά μεταξύ τους έχουν κοινά χαρακτηριστικά)

61 Πλεονεκτήματα της PFGE  μέθοδος αναφοράς για διερεύνηση ενδονοσοκομειακών λοιμώξεων  μεγάλη επαναληψιμότητα  διαθέσιμα εμπορικά kits (Staphylococcus aureus, Pseudomonas aeruginosa etc)

62

63 ΠΑΡΟΥΣΙΑ ΚΛΩΝΟΥ ΣΕ ΜΙΑ ΚΛΙΝΙΚΗ ΠΑΡΟΥΣΙΑ ΚΛΩΝΟΥ ΣΕ ΜΙΑ ΚΛΙΝΙΚΗ  ΜΕΤΑΔΟΣΗ ΑΠΟ ΑΣΘΕΝΗ ΣΕ ΑΣΘΕΝΗ  ΛΗΨΗ ΕΙΔΙΚΩΝ ΜΕΤΡΩΝ ΠΡΟΛΗΨΗΣ  ΕΝΗΜΕΡΩΣΗ-ΕΚΠΑΙΔΕΥΣΗ ΤΟΥ ΙΑΤΡΙΚΟΥ ΚΑΙ ΠΑΡΑ-ΙΑΤΡΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ ΠΑΡΑ-ΙΑΤΡΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ

64 ΠΑΡΟΥΣΙΑ ΔΙΑΦΟΡΕΤΙΚΩΝ ΠΟΛΥΑΝΘΕΚΤΙΚΩΝ ΚΛΩΝΩΝ  ΕΥΡΕΙΑ ΚΑΤΑΝΑΛΩΣΗ ΑΝΤΙΒΙΟΤΙΚΩΝ  ΑΛΛΑΓΗ ΠΟΛΙΤΙΚΗΣ ΧΡΗΣΗΣ ΑΝΤΙΒΙΟΤΙΚΩΝ

65 Πλεονεκτήματα των μοριακών τεχνικών έναντι των κλασσικών τεχνικών  Ταχύτητα στην ανίχνευση-ταυτοποίηση του λοιμογόνου παράγοντα  Εφαρμογή αιτιολογικής θεραπείας  Σημαντική βοήθεια στη κατανόηση της παθογένειας των λοιμώξεων

66 Μειονεκτήματα των μοριακών τεχνικών έναντι των κλασσικών τεχνικών  υψηλό κόστος ?  εξειδικευμένο προσωπικό ?  κατάλληλο εξοπλισμό ?

67 Αξιολόγηση του αποτελέσματος  Απαιτεί εμπειρία  Συνδυασμός με τα αποτελέσματα των συμβατικών μεθόδων συμβατικών μεθόδων  Επικοινωνία με τον κλινικό ιατρό

68 Μοριακή διάγνωση Φυματίωσης Bayes’s Theorem C = (DxA) / (DxA) + (1-D) (1-B) C = (DxA) / (DxA) + (1-D) (1-B) A: Sensitivity, B: Specificity C: Positive Predictive Value (PPV), D: Disease Prevalence ΥΠΟΘΕΣΗ TB diagnostic assay with 99% Sensitivity (!!!) and 99% Specificity (!!!!)  disease prevalence 1%: PPV 50%  disease prevalence 10%: PPV 91%  disease prevalence 20%: PPV 96%

69 Eργαστήριο Μοριακής Μικροβιολογίας, Ινστιτούτο Τεχνολογίας και Έρευνας Θεσσαλίας, Α. Πραττή Α. Πουλτσίδης Α. Στέφος Ν. Γκατσέλης Ε. Μάλλη Δ. Κλάψα Μ. Καρανίκα Μ. Μοράβα Σ. Νικολάου, Ε. Τιγκίρογλου

70


Κατέβασμα ppt "Τεχνικές Μοριακής Βιολογίας για τη Διάγνωση και Παρακολούθηση Λοιμωδών Νοσημάτων Έφη Πετεινάκη 1,2 1 Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Πανεπιστημίου."

Παρόμοιες παρουσιάσεις


Διαφημίσεις Google